ID: 1132621868

View in Genome Browser
Species Human (GRCh38)
Location 16:871603-871625
Sequence GCTTTAGTGATCCGCAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132621861_1132621868 14 Left 1132621861 16:871566-871588 CCCATGACTGCACATTTCTGTGC 0: 1
1: 3
2: 1
3: 23
4: 208
Right 1132621868 16:871603-871625 GCTTTAGTGATCCGCAAGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1132621860_1132621868 17 Left 1132621860 16:871563-871585 CCTCCCATGACTGCACATTTCTG 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1132621868 16:871603-871625 GCTTTAGTGATCCGCAAGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1132621859_1132621868 27 Left 1132621859 16:871553-871575 CCAGAACATTCCTCCCATGACTG 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1132621868 16:871603-871625 GCTTTAGTGATCCGCAAGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1132621862_1132621868 13 Left 1132621862 16:871567-871589 CCATGACTGCACATTTCTGTGCA 0: 1
1: 0
2: 0
3: 25
4: 224
Right 1132621868 16:871603-871625 GCTTTAGTGATCCGCAAGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132621868 Original CRISPR GCTTTAGTGATCCGCAAGGC GGG Intronic