ID: 1132622178

View in Genome Browser
Species Human (GRCh38)
Location 16:872991-873013
Sequence CAGTGGGGAACTCTAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132622163_1132622178 27 Left 1132622163 16:872941-872963 CCTGCCTGAGTGTATTTCCAAAG 0: 1
1: 0
2: 1
3: 7
4: 188
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622171_1132622178 2 Left 1132622171 16:872966-872988 CCCTTGGGTCATCCTGCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622167_1132622178 10 Left 1132622167 16:872958-872980 CCAAAGCCCCCTTGGGTCATCCT 0: 1
1: 0
2: 0
3: 7
4: 150
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622168_1132622178 4 Left 1132622168 16:872964-872986 CCCCCTTGGGTCATCCTGCTGTG 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622169_1132622178 3 Left 1132622169 16:872965-872987 CCCCTTGGGTCATCCTGCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622162_1132622178 28 Left 1132622162 16:872940-872962 CCCTGCCTGAGTGTATTTCCAAA 0: 1
1: 0
2: 3
3: 41
4: 500
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622177_1132622178 -10 Left 1132622177 16:872978-873000 CCTGCTGTGGGCTCAGTGGGGAA 0: 1
1: 0
2: 2
3: 24
4: 249
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622164_1132622178 23 Left 1132622164 16:872945-872967 CCTGAGTGTATTTCCAAAGCCCC 0: 1
1: 0
2: 2
3: 10
4: 155
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
1132622173_1132622178 1 Left 1132622173 16:872967-872989 CCTTGGGTCATCCTGCTGTGGGC 0: 1
1: 0
2: 0
3: 28
4: 311
Right 1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132622178 Original CRISPR CAGTGGGGAACTCTAGCCTC AGG Intronic
900891630 1:5453967-5453989 CAGTGGGGAATACAAGCCTGTGG + Intergenic
901627790 1:10633546-10633568 CAGGTGGGAGCTCCAGCCTCAGG + Intergenic
903263866 1:22144913-22144935 CAGTGGTGTACTCTGTCCTCGGG + Intergenic
904290576 1:29483248-29483270 CAGTCTGGAACTCTGGCCTCTGG - Intergenic
906845394 1:49186040-49186062 CATCGGGGAACTCTAGTCCCAGG - Intronic
915068839 1:153248660-153248682 CTGTGGGCCACTCTAGACTCAGG - Intergenic
915534367 1:156526112-156526134 CAGAGGGGAAATCAAGCCGCTGG + Exonic
1062877769 10:955927-955949 CAGTGGGGAACAGTGGCCTCAGG - Intergenic
1063974528 10:11404811-11404833 CAGTGGGGAAACTGAGCCTCAGG - Intergenic
1064261831 10:13792331-13792353 CAGTGGAGACCTCTGGCCACAGG + Intronic
1065012595 10:21432876-21432898 CAGTGTGGAATTCCAGGCTCTGG + Intergenic
1069864277 10:71491890-71491912 GAGTGGGGAAGGCTCGCCTCTGG - Intronic
1076892863 10:133293355-133293377 CAGAGGGGAACTTTTGCCCCAGG + Intronic
1077282362 11:1751434-1751456 CAGGGGGGGACTCCAGGCTCAGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1083998078 11:66282063-66282085 CAGAAGGGAACCCTAGCGTCTGG - Intronic
1086242264 11:84709596-84709618 CAGTGCCAAACTCTACCCTCAGG + Intronic
1088110743 11:106258579-106258601 CACTGGAGAACTGAAGCCTCAGG - Intergenic
1091209440 11:133843838-133843860 GAGTGCAGAATTCTAGCCTCGGG + Intronic
1091370150 11:135050865-135050887 CAGTGGGTGACTCTTGCCACAGG + Intergenic
1092472851 12:8794407-8794429 CAGAGGGGAACTCTAGGCCAGGG - Intergenic
1095602896 12:44034326-44034348 CAGTGAGGGGCTCTATCCTCGGG + Intronic
1096661182 12:53125048-53125070 AAGTGGGGAACATTAGTCTCAGG + Intergenic
1103341863 12:120225060-120225082 CAGTGGGGGCCTGGAGCCTCTGG - Intronic
1103726559 12:123000099-123000121 CTGTGGGGAACTCGGGCCCCCGG - Intronic
1103895152 12:124268227-124268249 CAGTTGGGAAGTCAAGCTTCTGG + Intronic
1104703164 12:130922607-130922629 CTGTGGGAAATTCCAGCCTCTGG - Intergenic
1105892083 13:24689184-24689206 CCGTGGAGAGCTCTAGCCCCAGG + Intronic
1109321671 13:60817991-60818013 CAGCCGGGAACTCTGGGCTCAGG + Intergenic
1110373764 13:74768658-74768680 CAGTGGGGAATTTTAGCCTCTGG + Intergenic
1115503033 14:34065926-34065948 CAGTAGAGAAATCTAGCCTGCGG - Intronic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1125279811 15:38031574-38031596 CAGTGAAGAACTGAAGCCTCCGG + Intergenic
1126673456 15:51137021-51137043 CAGGAGGGACTTCTAGCCTCTGG - Intergenic
1126963376 15:54024103-54024125 CAGTGGGGCAATTTAGGCTCTGG + Intronic
1129872471 15:78949387-78949409 TAGTGGAGAACTCTGGACTCAGG - Intronic
1129946547 15:79543497-79543519 GAGTGGGGAAGTTTAGCCTTGGG + Intergenic
1132109364 15:99091178-99091200 CAGTGAGTAACTGAAGCCTCTGG - Intergenic
1132325315 15:100964069-100964091 CAGTGAGAAATGCTAGCCTCTGG + Intronic
1132344772 15:101101487-101101509 CAGTGGGGAAATAAAGCTTCAGG + Intergenic
1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG + Intronic
1135980919 16:27146775-27146797 CATGGGGGAACTCTAGCAGCTGG - Intergenic
1141446562 16:84062566-84062588 CACTGGGGAACTCGAGGCACAGG - Intronic
1142517714 17:443539-443561 CAGTGGGGACCCCAAGCCCCCGG - Intronic
1143393125 17:6571916-6571938 CAGTGTGGACCTCTCGGCTCTGG + Intergenic
1145975064 17:28979107-28979129 CTGTGAGGACCTGTAGCCTCAGG + Intronic
1146555286 17:33817834-33817856 CATTGGAGAACTCTAGCCCCAGG - Intronic
1146804627 17:35855488-35855510 TAGGGGGGAATTCTAGCCACAGG + Intronic
1148152984 17:45407210-45407232 CGGTGGGGACCTCTAGCAACTGG - Intronic
1149869408 17:60168652-60168674 CAGTGAGCAACTCTGGCCCCTGG + Intronic
1150877674 17:68987550-68987572 CAGAAGGGCACTCTAGCCACAGG + Intronic
1156632589 18:38987977-38987999 AAGTGGGGAGTTCTAGCCTGTGG - Intergenic
1160532574 18:79574165-79574187 CTTTGGGGAGCTCTGGCCTCTGG - Intergenic
1163402305 19:17101545-17101567 GGGTGGGGAACTCCAGCATCGGG + Intronic
930102796 2:47616143-47616165 CAGTGGGGAGCTCTAGACCTGGG - Intergenic
936340790 2:111630900-111630922 TAGTGGGGACCTCCAGCCTCAGG - Intergenic
941379705 2:164777999-164778021 CAGTGGTGAGATCTAGCCACTGG - Intronic
1169772113 20:9212525-9212547 CAATGGGGAACTTTAGCCAAGGG - Intronic
1170680784 20:18523287-18523309 CAGGGGAGAGCTCCAGCCTCAGG - Intronic
1172005793 20:31818616-31818638 CCGAGGGGCACTCTAGCCTGAGG - Intergenic
1172845117 20:37925602-37925624 AAGTGGGAAACTCAAGGCTCTGG - Intronic
1173836937 20:46132109-46132131 CACTGGGGATCACTTGCCTCAGG + Intergenic
1174363701 20:50043855-50043877 CAGTGGGGAGGGCTGGCCTCTGG - Intergenic
1174553789 20:51379800-51379822 CAGTGGGGAACTGAGGCCTTCGG - Intergenic
1176013315 20:62912465-62912487 CAGTGGCTAACTCCAGCCTGGGG - Intronic
1176156640 20:63625521-63625543 TAGTGGGGAACCCAAGCCTTGGG - Intronic
1179568778 21:42265622-42265644 CAGTGAGGACTTCCAGCCTCCGG + Intronic
1182681049 22:32080275-32080297 CAGAGGGGAACTATGGCATCAGG + Intronic
950317306 3:12014661-12014683 CAGTGTGAAACTCCAACCTCAGG + Intronic
957414067 3:79878264-79878286 CAGTGGTGAACTCTACTCACTGG + Intergenic
961043942 3:123696058-123696080 TAGTGGTGAACTCTAGCCCATGG + Intronic
962129559 3:132659062-132659084 CGGTGGGGAACGCTACTCTCAGG + Intronic
963355268 3:144203313-144203335 AAGTTGGGAAGTGTAGCCTCTGG + Intergenic
972505982 4:39720577-39720599 AAGTTGGGTATTCTAGCCTCAGG + Intronic
977209526 4:94203528-94203550 GAGAGTGGAAATCTAGCCTCAGG + Intergenic
979949175 4:126870914-126870936 CAGTGAGGAACTTTAGCTCCTGG + Intergenic
981008035 4:139895873-139895895 CAGTGGAGAACTTTAGGCCCTGG - Intronic
984953870 4:185026242-185026264 CATTGGGGAGCTCTTTCCTCTGG - Intergenic
985300276 4:188481101-188481123 CAGTGGGCACCTCTGGACTCTGG + Intergenic
986120034 5:4826661-4826683 CAGTTGGGAGCTCCAGGCTCAGG - Intergenic
987182635 5:15384389-15384411 CCGTGGGGAATTTTAGCCTCAGG - Intergenic
987899271 5:23989822-23989844 CAGAGGAGAACCCTAGCATCTGG - Intronic
997699260 5:135885040-135885062 CAGCAGGGAAGTGTAGCCTCAGG - Intronic
999868450 5:155727310-155727332 TAGTGGGGAAATTGAGCCTCAGG - Intergenic
1000333297 5:160223055-160223077 CAGTCTTGAACTCTAGGCTCAGG + Intronic
1001313648 5:170628056-170628078 GAGTGGGGAATTCCCGCCTCTGG + Intronic
1003639129 6:7861977-7861999 CAGTGGGGACCTCAAGCTGCTGG - Intronic
1006341011 6:33447082-33447104 TAGTGGGGAGCTCTGGCCTAGGG - Intronic
1007702556 6:43773289-43773311 CAGAGGGGCACTCTAGCCTACGG - Intronic
1009906224 6:69872849-69872871 CACTGGGGAACTCTGGGGTCTGG + Intronic
1016612654 6:146009938-146009960 CAGTGTGGGACTCTGGCCTCTGG - Intergenic
1023115357 7:36856651-36856673 CAGTACAGAACTCCAGCCTCTGG - Intronic
1024272098 7:47650396-47650418 AAATGAGGGACTCTAGCCTCAGG - Intergenic
1024565465 7:50676609-50676631 CAGAGGGGCACTCTGCCCTCTGG + Intronic
1026501249 7:70945028-70945050 CAAAGAGGAGCTCTAGCCTCTGG + Intergenic
1027846645 7:83386201-83386223 CAGTGGAGGACTCAAGCCTCTGG - Intronic
1028507126 7:91582900-91582922 CACTGAGGAGCTCCAGCCTCAGG + Intergenic
1033666036 7:143441565-143441587 CAGTTGGGAACTCTATCTCCTGG + Intergenic
1034294868 7:149963260-149963282 CAGTGGGGAACTGCTGCCCCAGG + Intergenic
1034811196 7:154133692-154133714 CAGTGGGGAACTGCTGCCCCAGG - Intronic
1037270795 8:17128092-17128114 CAGTAGAGAACTCTGGCTTCAGG - Intergenic
1038276378 8:26124773-26124795 CAGTGGCAAACTATAGCCTGTGG + Intergenic
1040950551 8:52934863-52934885 CAGTGTGTGACTCTAGCCCCAGG - Intergenic
1043741302 8:83815305-83815327 CACTGGGGAACTCCAGCAGCTGG + Intergenic
1046975082 8:120265967-120265989 CAGAGGGGATGTCTAGCCTCAGG - Intronic
1047701047 8:127449759-127449781 CAGTGCGAACCTCAAGCCTCTGG - Intergenic
1049222243 8:141433438-141433460 CAGTCGGGACCCCCAGCCTCGGG - Intergenic
1053445514 9:38150286-38150308 CACTGGGGAACTCTAGGAGCTGG - Intergenic
1057580926 9:96287199-96287221 CAGTGGGGAACACTGGCAACAGG - Intronic
1059164572 9:112066024-112066046 CAGTGAGGAAATCAAGGCTCAGG + Intronic
1061620151 9:131806698-131806720 CTGTGGGGAGACCTAGCCTCTGG + Intergenic
1187805813 X:23119252-23119274 CAGTGCCCAACTCTAGCCCCAGG + Intergenic
1189029608 X:37437151-37437173 TAGTGGTGAACTTTAGTCTCTGG + Intronic
1191793438 X:64995703-64995725 CAGTGTGGAACACTGGACTCTGG + Intronic
1199548450 X:149032563-149032585 CAGAGGGCAACTATAGTCTCTGG - Intergenic