ID: 1132622318

View in Genome Browser
Species Human (GRCh38)
Location 16:873646-873668
Sequence GAGGGTCCCCGCGAGCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132622318_1132622327 16 Left 1132622318 16:873646-873668 CCCCTGCGCTCGCGGGGACCCTC 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1132622327 16:873685-873707 TGTGTTCCAGGTGGGCACTCTGG 0: 1
1: 0
2: 0
3: 20
4: 218
1132622318_1132622325 7 Left 1132622318 16:873646-873668 CCCCTGCGCTCGCGGGGACCCTC 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1132622325 16:873676-873698 GAAATGCATTGTGTTCCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1132622318_1132622328 19 Left 1132622318 16:873646-873668 CCCCTGCGCTCGCGGGGACCCTC 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1132622328 16:873688-873710 GTTCCAGGTGGGCACTCTGGTGG 0: 1
1: 0
2: 1
3: 14
4: 160
1132622318_1132622324 4 Left 1132622318 16:873646-873668 CCCCTGCGCTCGCGGGGACCCTC 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1132622324 16:873673-873695 GAGGAAATGCATTGTGTTCCAGG 0: 1
1: 0
2: 2
3: 12
4: 194
1132622318_1132622329 20 Left 1132622318 16:873646-873668 CCCCTGCGCTCGCGGGGACCCTC 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1132622329 16:873689-873711 TTCCAGGTGGGCACTCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 175
1132622318_1132622326 8 Left 1132622318 16:873646-873668 CCCCTGCGCTCGCGGGGACCCTC 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1132622326 16:873677-873699 AAATGCATTGTGTTCCAGGTGGG 0: 1
1: 0
2: 2
3: 18
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132622318 Original CRISPR GAGGGTCCCCGCGAGCGCAG GGG (reversed) Intronic
903498922 1:23791304-23791326 GAGGGTCCCGGAGAGCGGGGAGG + Intronic
904772111 1:32886361-32886383 GGGGGTCCCCGCCAGCCCTGGGG - Intronic
905137033 1:35808079-35808101 CAGGGTCCCGGCGGGCGGAGGGG - Intergenic
906627184 1:47334430-47334452 GGGGGTCCCCCAGCGCGCAGAGG + Intronic
907046520 1:51303215-51303237 GAGGCTCCCAGAGAGGGCAGGGG + Intronic
910550227 1:88466981-88467003 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
911853888 1:102853700-102853722 GAGGGGCCCCTTCAGCGCAGTGG - Intergenic
912069811 1:105795831-105795853 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
923353123 1:233129046-233129068 GAGGGGCCCCCACAGCGCAGTGG - Intronic
1064694423 10:17950982-17951004 GAGGGTCCCCCACAGCGCAGCGG + Intergenic
1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG + Intergenic
1077100422 11:819965-819987 GATGGTCTCCGTGAGCGGAGGGG + Intronic
1079083698 11:17430784-17430806 GAGGGTCCGGGCGAGGGCACTGG - Intronic
1082734858 11:56845106-56845128 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
1084553975 11:69864983-69865005 GAGGGTCCCTGGGACTGCAGAGG + Intergenic
1089954409 11:122556731-122556753 GAGGGGCCCCCACAGCGCAGCGG - Intergenic
1092615612 12:10213210-10213232 CAGGGTCCCCGTGAGTGTAGAGG + Exonic
1093154567 12:15665820-15665842 GACGGTCCCAGGGGGCGCAGGGG + Exonic
1093711612 12:22334809-22334831 GAGGGTCCCGGCGGGCGAGGCGG - Intronic
1094385510 12:29889050-29889072 GAGGGATCCCGACAGCGCAGCGG + Intergenic
1103954144 12:124567272-124567294 GAGGGTCCCCGCGAAGGGCGGGG - Intronic
1104929203 12:132329376-132329398 GGGGGTCCCCCAGAGCGCAGAGG + Intergenic
1105349305 13:19601746-19601768 GAGGGTCTCCGGGAGCCCAGAGG + Intergenic
1106340315 13:28820545-28820567 GAGCGTCTCCGTGAGGGCAGTGG + Exonic
1106950016 13:34872928-34872950 GAGGGTCCCCGCCAGCAAAAAGG - Intergenic
1108524953 13:51278643-51278665 GAGGGTGCCCACGTGCACAGTGG - Intronic
1109861266 13:68201750-68201772 AAGGGTCCCCACTAGGGCAGTGG - Intergenic
1116084441 14:40217235-40217257 GAGGGCCCCCCACAGCGCAGCGG + Intergenic
1116437539 14:44912091-44912113 GTGGGACCCCTCCAGCGCAGCGG - Intergenic
1117183703 14:53217931-53217953 GAGGGGCCCCCATAGCGCAGTGG + Intergenic
1118016064 14:61662501-61662523 GAAGGTCACCGCCAGGGCAGTGG - Intergenic
1118137557 14:63045824-63045846 GAGGGTGCCAGAGAGAGCAGTGG + Intronic
1119793649 14:77376793-77376815 AAGGGGCCCCGCGCGCGAAGGGG + Intronic
1120169629 14:81236021-81236043 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
1121101573 14:91253581-91253603 GAGCGGCCCCGCGAGCGCGGGGG - Intronic
1122451508 14:101812318-101812340 CAGGGTGCCCGGGAGAGCAGGGG + Intronic
1122548324 14:102537227-102537249 GAGGGTCCAGCCGGGCGCAGTGG - Intergenic
1124584294 15:30991391-30991413 GAGGCTCCACGGAAGCGCAGAGG + Intronic
1126165590 15:45651442-45651464 GAGGGGCCCCCACAGCGCAGTGG + Intronic
1128501220 15:68229072-68229094 GAGGGACCCCGAGAACGCGGAGG + Intronic
1130162312 15:81413966-81413988 GAGGGGCCCCCACAGCGCAGCGG - Intergenic
1132498975 16:276271-276293 GAGGGTCTCAGGGAGGGCAGCGG + Intronic
1132602568 16:780182-780204 GAGGGTCCCGGCGGGAGCAGGGG + Intronic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1133041853 16:3065142-3065164 GAGGGGCGCCGTGAGGGCAGGGG - Intergenic
1134005784 16:10818299-10818321 GAGGGGCCCCGCCAGCTCGGAGG - Intronic
1134121152 16:11586213-11586235 CGGGCACCCCGCGAGCGCAGGGG - Intronic
1136498090 16:30656051-30656073 GAGGAACCCCGGGAGCGCAATGG + Exonic
1139468153 16:67164959-67164981 GAGGGACCCCGGGACCACAGGGG - Intronic
1140745510 16:77977045-77977067 GAGGTGCCCCTGGAGCGCAGGGG - Intronic
1141538652 16:84700481-84700503 GGGAGTCCCCTGGAGCGCAGGGG + Intronic
1141959053 16:87392470-87392492 GAGTGTCGCCGCGAGGGCGGCGG + Intronic
1143017277 17:3897735-3897757 GTGGGTCCCAGCCAGGGCAGAGG - Exonic
1143598396 17:7929232-7929254 GAGGGCCCCAGCGGGCGCTGGGG + Exonic
1147805288 17:43126763-43126785 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
1150854075 17:68733928-68733950 GTGGGTCCCAGCAAGCACAGTGG + Intergenic
1152135316 17:78500054-78500076 GAGGGTCACCTCCAGGGCAGGGG + Intronic
1152472173 17:80495823-80495845 GAGGGTCCCAGCCACCTCAGTGG + Intergenic
1152587768 17:81196676-81196698 GAGCGGCCCGGGGAGCGCAGAGG - Intronic
1158505629 18:58044268-58044290 CCGGGTCCCCGGGAGCGCAGAGG + Intergenic
1159040687 18:63320407-63320429 GCCGGGCCCCGCGGGCGCAGCGG - Intergenic
1159743899 18:72209048-72209070 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG + Intronic
1163433409 19:17281816-17281838 GAGGGGCCCCCCGAGCCGAGGGG + Exonic
1165759986 19:38315499-38315521 GTGGCCCCCCGGGAGCGCAGAGG - Intronic
1165901778 19:39172671-39172693 CAGGGTCCCACCGAGCCCAGGGG + Intronic
1166367380 19:42284425-42284447 GACGGCCCCCGCGCGCGCCGGGG + Intronic
1166694856 19:44846632-44846654 GGGGGTCCGCGCGAGGGCAGGGG - Intronic
1167267416 19:48490623-48490645 CAGGGTCCACGCGAGAGCAGCGG + Intronic
1167446945 19:49543336-49543358 GGGGGTCCCTGAGAGCCCAGGGG - Exonic
1167494166 19:49808369-49808391 CAGTGTCCCCGCCTGCGCAGTGG + Intronic
925265332 2:2562993-2563015 GAGGCTCCCCAAGAGCTCAGGGG - Intergenic
925271970 2:2616467-2616489 GAGGAACCCAGCGAGGGCAGTGG + Intergenic
927137417 2:20106966-20106988 GAGGGGCCCCCACAGCGCAGCGG + Intergenic
927652185 2:24919715-24919737 GACGGTCCCCGCGCGGGCTGGGG + Exonic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928341627 2:30447642-30447664 GAGGGGCCGCGCGAGCGGCGAGG + Intronic
928793805 2:34991972-34991994 GAGGGGCCCCCACAGCGCAGCGG - Intergenic
933829512 2:86195507-86195529 AAGGGGCCGCGCGTGCGCAGTGG - Exonic
938315882 2:130327804-130327826 GAGGGGCCCCCACAGCGCAGCGG - Intergenic
938370064 2:130763125-130763147 GAGGGTCCCTGCAGGGGCAGAGG - Exonic
942058097 2:172204106-172204128 AAGGGGCCGGGCGAGCGCAGTGG - Intergenic
942903064 2:181145906-181145928 GAGGGGCCCCCACAGCGCAGTGG + Intergenic
948545200 2:238723138-238723160 GAGGGGCCCCCACAGCGCAGCGG + Intergenic
948795538 2:240400441-240400463 GAGGGTCCCGGAGATCGAAGGGG + Intergenic
948803710 2:240444055-240444077 GAGGGGCACCGGGAGCGCACAGG + Intronic
1171867716 20:30500496-30500518 TAGGGCCCCCGCCAGGGCAGAGG + Intergenic
1174573827 20:51523414-51523436 GAGGGGCTCCGGGAGCGCTGGGG + Exonic
1174713150 20:52728328-52728350 GAGGGGCCCCCACAGCGCAGTGG + Intergenic
1179025437 21:37675480-37675502 GAGGGTCCCCGCGATGACAGTGG - Intronic
1179826248 21:43968152-43968174 GAGGGTCCCGGGGAGGGCCGGGG + Intronic
1180190931 21:46162113-46162135 GAGGGCACCCTCGAGGGCAGTGG - Intronic
1180226796 21:46398305-46398327 GACAGTCCCAGCGAGCGCAGGGG - Intronic
1180737001 22:18024575-18024597 GCGGCTCCGCGCGAGCGCCGTGG + Intergenic
1181085953 22:20439396-20439418 GAGTGTCCCCTCCAGCCCAGGGG - Intronic
949133663 3:536202-536224 GAGGGGCCCCCTCAGCGCAGCGG + Intergenic
953096219 3:39779673-39779695 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
957919920 3:86733517-86733539 GAGGGGCCCCCACAGCGCAGCGG + Intergenic
966860653 3:184229636-184229658 GAGGGCCACCCGGAGCGCAGAGG + Intronic
972784685 4:42315495-42315517 GAGGGGCCCCCACAGCGCAGCGG + Intergenic
979829298 4:125280873-125280895 GAGGGGCCCCCCCAGTGCAGTGG - Intergenic
981002123 4:139838068-139838090 GAGGCTCCCAGCGAGAGCATGGG + Intronic
982024291 4:151236169-151236191 GAGGGGCCCCCACAGCGCAGCGG - Intronic
982758279 4:159250846-159250868 GAGGGGCCCCCATAGCGCAGTGG - Intronic
982773644 4:159420823-159420845 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
983734657 4:171043093-171043115 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
984095423 4:175427847-175427869 GAGGGGCCCCCACAGCGCAGCGG - Intergenic
985779041 5:1860259-1860281 GCGAGGCCCCGCGAGCACAGTGG - Intergenic
988291807 5:29296871-29296893 GAGGGGCCCCCACAGCGCAGTGG + Intergenic
989750305 5:44884361-44884383 GAGGGTCCCCCACAGCGCAGTGG + Intergenic
992098173 5:73381584-73381606 GAGGCGCCGCGGGAGCGCAGGGG - Intergenic
996221337 5:120936743-120936765 GAGGGGCCCCTACAGCGCAGCGG - Intergenic
996379040 5:122845517-122845539 TCGGGGCCCCGCGGGCGCAGCGG + Exonic
997329277 5:133047469-133047491 GAGGGGCCCCCACAGCGCAGGGG - Intergenic
1003623906 6:7726322-7726344 GACGGTGCCCGAGAGCTCAGGGG + Intergenic
1003824854 6:9942099-9942121 GAGGGGCCCCCACAGCGCAGTGG - Intronic
1003901534 6:10659810-10659832 GAGGGGCCCCGACAGCGCAGAGG - Intergenic
1004688815 6:17974363-17974385 GAGGTTCCCGCCGGGCGCAGTGG - Intronic
1006472415 6:34236464-34236486 GGGGGTCCACGCGGGCCCAGGGG - Intergenic
1006978421 6:38124755-38124777 GAGGGGCCCCCACAGCGCAGTGG + Intronic
1008446506 6:51598308-51598330 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
1009873120 6:69473006-69473028 GAGGGTCCCCCACAGTGCAGTGG - Intergenic
1010205080 6:73315190-73315212 GAGGGTTCCCGCGATCGCCAGGG - Intergenic
1012474896 6:99607458-99607480 GAGGAGACCCGAGAGCGCAGGGG - Intronic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1018720656 6:166569495-166569517 CAGGGACCCAGCGAGGGCAGAGG - Intronic
1019379131 7:712244-712266 GAGGGTCCTCGCCGGCGCTGAGG - Intronic
1021006221 7:15397442-15397464 GAGGGCCCCCCACAGCGCAGCGG + Intronic
1022109671 7:27220599-27220621 CAGGGTCCCCGCCAGCCCCGCGG - Intergenic
1023821246 7:43981790-43981812 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1024370894 7:48582596-48582618 GAGCCTCCCCGCAAGCACAGAGG - Intronic
1029672778 7:102045427-102045449 GAGGGGGCGCGCGGGCGCAGTGG - Intronic
1029749515 7:102535214-102535236 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1029767463 7:102634317-102634339 GAGGGGCCCCGCAGGAGCAGGGG - Intronic
1034389916 7:150778092-150778114 GAGGGTTTCCACGAGGGCAGAGG - Intergenic
1034544829 7:151782916-151782938 CTGGCTCCCCGCGAGCGCTGCGG - Intronic
1034711251 7:153193266-153193288 GAGGAGCCCCGCGGGCGAAGAGG + Intergenic
1035039491 7:155917112-155917134 GAGGGTCCCCCAGAGTGCTGAGG - Intergenic
1037273924 8:17157154-17157176 GAAGGTCCCCGGGACCGCTGTGG + Intronic
1038687153 8:29729043-29729065 GAGAGTCCCAGGGAGCACAGGGG - Intergenic
1038726646 8:30088066-30088088 GAGGGACCCCCACAGCGCAGCGG - Intergenic
1039765534 8:40624306-40624328 GAGGGTCAGCGAGAGGGCAGTGG + Intronic
1044457138 8:92401565-92401587 GAGGGTCCCCCACAGTGCAGCGG + Intergenic
1045407450 8:101880444-101880466 GAGGGGCCCCCACAGCGCAGTGG + Intronic
1048965625 8:139612457-139612479 GAGGGTCCCCGCAAGCCCGTCGG - Intronic
1049672507 8:143876250-143876272 GAGGGTCCCCTCTAGGGCTGGGG - Intronic
1049963452 9:757648-757670 AAGGGTCCCAGCCAGCACAGAGG + Intergenic
1050575216 9:6987930-6987952 GAGGATCCCCTCGAGCCCAGAGG + Intronic
1052494694 9:29212337-29212359 GAGGCTCCCAGCGGGCGCCGCGG - Intergenic
1055030569 9:71768732-71768754 GAGCGTCCCCGCGACAACAGGGG + Exonic
1055525897 9:77133708-77133730 GAGGGTCCCCACCAGCACAAAGG - Intergenic
1055654870 9:78441993-78442015 GAGGGGCCCCCACAGCGCAGTGG - Intergenic
1059191807 9:112333746-112333768 GAGGGTGGGCGCGAGCGCAGGGG - Intergenic
1203784348 EBV:119117-119139 GAGGGTCCTGGCGAGTGCTGTGG - Intergenic
1194451093 X:94045792-94045814 GAGGGTCCCCCACAGCCCAGCGG - Intergenic
1195553683 X:106197249-106197271 GAGGGTTCCCTCCAGGGCAGAGG + Intronic
1196741347 X:119028657-119028679 GAGGGGCCCCCACAGCGCAGTGG + Intergenic
1200095899 X:153662134-153662156 GCGGGTGGCGGCGAGCGCAGAGG + Intergenic