ID: 1132622852

View in Genome Browser
Species Human (GRCh38)
Location 16:875885-875907
Sequence GGTCCTGGGGTCCCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1804
Summary {0: 1, 1: 1, 2: 7, 3: 120, 4: 1675}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132622852_1132622860 17 Left 1132622852 16:875885-875907 CCAGCAGCTGGGACCCCAGGACC 0: 1
1: 1
2: 7
3: 120
4: 1675
Right 1132622860 16:875925-875947 TCAGGAGTCACCCGTGTGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 94
1132622852_1132622859 -1 Left 1132622852 16:875885-875907 CCAGCAGCTGGGACCCCAGGACC 0: 1
1: 1
2: 7
3: 120
4: 1675
Right 1132622859 16:875907-875929 CGCATGGCTGAAGACGGCTCAGG 0: 1
1: 0
2: 4
3: 75
4: 1248
1132622852_1132622857 -7 Left 1132622852 16:875885-875907 CCAGCAGCTGGGACCCCAGGACC 0: 1
1: 1
2: 7
3: 120
4: 1675
Right 1132622857 16:875901-875923 CAGGACCGCATGGCTGAAGACGG 0: 1
1: 0
2: 0
3: 11
4: 178
1132622852_1132622863 28 Left 1132622852 16:875885-875907 CCAGCAGCTGGGACCCCAGGACC 0: 1
1: 1
2: 7
3: 120
4: 1675
Right 1132622863 16:875936-875958 CCGTGTGTGTGGCCCCACCCAGG 0: 1
1: 1
2: 0
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132622852 Original CRISPR GGTCCTGGGGTCCCAGCTGC TGG (reversed) Intronic