ID: 1132623210

View in Genome Browser
Species Human (GRCh38)
Location 16:878024-878046
Sequence AGCCAGACCCCATGTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132623210_1132623215 24 Left 1132623210 16:878024-878046 CCAAACACACATGGGGTCTGGCT 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1132623215 16:878071-878093 CAGGAGCCCCCAGACGCGCGTGG 0: 1
1: 0
2: 1
3: 18
4: 192
1132623210_1132623216 25 Left 1132623210 16:878024-878046 CCAAACACACATGGGGTCTGGCT 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1132623216 16:878072-878094 AGGAGCCCCCAGACGCGCGTGGG 0: 1
1: 0
2: 2
3: 6
4: 61
1132623210_1132623217 26 Left 1132623210 16:878024-878046 CCAAACACACATGGGGTCTGGCT 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1132623217 16:878073-878095 GGAGCCCCCAGACGCGCGTGGGG 0: 1
1: 0
2: 1
3: 14
4: 78
1132623210_1132623212 5 Left 1132623210 16:878024-878046 CCAAACACACATGGGGTCTGGCT 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1132623212 16:878052-878074 GAACCGACTGAAGCTATTCCAGG 0: 2
1: 0
2: 2
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132623210 Original CRISPR AGCCAGACCCCATGTGTGTT TGG (reversed) Intronic
900225188 1:1529679-1529701 GGACAGGCCCCATGTGAGTTGGG + Intronic
901192795 1:7422478-7422500 GGCCAGACCCCCTCTGTGCTGGG + Intronic
901441445 1:9280739-9280761 GCCCAGCACCCATGTGTGTTTGG - Intergenic
902333271 1:15741302-15741324 AGCCACACCCCAAGTCTGTAAGG + Exonic
902954165 1:19913439-19913461 AGCCAGAGCCCTTGTGTGGATGG - Intergenic
903141731 1:21343264-21343286 AGCCAAACCCCATGTGAGGGAGG - Intronic
907421179 1:54348425-54348447 AGGCAGACCTCAGGTGTGTGAGG - Intronic
909864053 1:80644178-80644200 AGGCATACACCACGTGTGTTAGG + Intergenic
914811221 1:151029702-151029724 AGCAAGACCTCATCTCTGTTGGG + Intronic
921152505 1:212413626-212413648 TGCCAGACCCTAGGTGGGTTAGG + Intronic
922903318 1:229155101-229155123 AGAAATTCCCCATGTGTGTTGGG - Intergenic
1067772617 10:49138316-49138338 AGCCAGAGGCCATGTGAGTGAGG - Intergenic
1069738506 10:70672872-70672894 AGCCGGACCCCAGGTGCGTGCGG + Exonic
1070854820 10:79599259-79599281 AGCGAGACCCCATGTGTTGCAGG + Intergenic
1071778058 10:88811135-88811157 AGGGAGACTGCATGTGTGTTTGG + Intronic
1072063649 10:91842932-91842954 TGCCAGTCCCCATGTGCTTTGGG + Intronic
1072853628 10:98924208-98924230 AGAGAGACTCCATGTGTTTTGGG - Intronic
1073248933 10:102110034-102110056 AGCCTGTCCCCAGGTGTGTGTGG - Exonic
1074320048 10:112393229-112393251 AGCCAGGTCCCATGGGTGCTAGG - Intronic
1076129356 10:128002156-128002178 AGCCAGAGCCTATGTGTCTGTGG + Intronic
1078758336 11:14232437-14232459 AGCCAGAGAGCATGTGGGTTGGG - Intronic
1079010899 11:16827440-16827462 CTCCAGAGCCCATGTGTGTTAGG + Intronic
1081576594 11:44322490-44322512 CGCCAGACCCCGAGTGTATTGGG + Intergenic
1081763894 11:45595840-45595862 ATCCAGACCTCAGGTGTGGTGGG + Intergenic
1083929894 11:65835743-65835765 AGCCAGACTGCATGTGTTTGGGG + Intronic
1084459045 11:69286088-69286110 AGCAAGACCCCCTGTGAGCTGGG - Intergenic
1090199933 11:124846561-124846583 AGACAGGGCCCATGTGTTTTGGG - Intergenic
1100545953 12:95602600-95602622 AGGCAGACTCCATGTGGCTTAGG - Intergenic
1101649164 12:106659217-106659239 AGCCAGACCCCAGCTGGGCTAGG - Intronic
1102483641 12:113241417-113241439 AGCCAGCCCCCAGGTGTTTCTGG + Intronic
1103008793 12:117441879-117441901 ACCCAGACCCCACGTGGGTTGGG + Intronic
1105239124 13:18594806-18594828 AACCAGGCCCCATCTTTGTTTGG - Intergenic
1106531557 13:30597838-30597860 AGCCTGACCCCTGGTGTGTAGGG + Intronic
1106679520 13:31995812-31995834 AGCCAGTCCTCATGTTAGTTTGG - Intergenic
1110482849 13:76001541-76001563 AATCAGACCCTATGTGTCTTGGG + Intergenic
1113922369 13:113920266-113920288 TGCCAGGCCCCATGTGTGCTGGG + Intergenic
1118686836 14:68299811-68299833 AGCCAGATCACATGGGTATTGGG + Intronic
1118767895 14:68922327-68922349 AGCCAGATCCCATCTGTGGCAGG - Intronic
1119657618 14:76428631-76428653 AGCCTGAGCTCATGTGTGCTGGG + Intronic
1119670624 14:76515482-76515504 AGCCCCACCCCATGTGTGTGGGG - Intergenic
1125048652 15:35272505-35272527 ACCCAAACACCATGGGTGTTTGG - Intronic
1126049224 15:44671773-44671795 AGACAAAACCCAAGTGTGTTTGG + Intronic
1126098764 15:45107231-45107253 AGCCAGGCACCTTCTGTGTTGGG - Intronic
1126294882 15:47129093-47129115 AGACAGACACTCTGTGTGTTTGG - Intergenic
1128977880 15:72166762-72166784 AGCCAGCCCCCTTGTGGATTGGG + Intronic
1132623210 16:878024-878046 AGCCAGACCCCATGTGTGTTTGG - Intronic
1132623235 16:878136-878158 AGCCGGACCCCACGCGTGTTTGG - Intronic
1134386768 16:13780858-13780880 AGCCAGTCCCCATGTGTCCTGGG + Intergenic
1135199420 16:20424085-20424107 AACAATACCCCATATGTGTTGGG + Intronic
1135219277 16:20599525-20599547 AGTAATACCCCATATGTGTTGGG - Intergenic
1135940713 16:26819474-26819496 AGCCAAACCCCTAGTTTGTTGGG - Intergenic
1141436025 16:84000348-84000370 AGCAAGACCCCATCTCTATTGGG + Intronic
1142772309 17:2107308-2107330 TGACAGTCCCCATTTGTGTTTGG - Intronic
1144437962 17:15258336-15258358 AGCCAGGAGCCCTGTGTGTTTGG - Intronic
1145007831 17:19347577-19347599 AGCCACACACCAGGTGGGTTGGG - Intronic
1147557521 17:41488852-41488874 AGCCACACCCCAGGTGTGGGGGG + Intronic
1148247913 17:46047602-46047624 AGCAAGACCCCATCTTTGTAGGG + Intronic
1149040172 17:52178747-52178769 AGACGGACTCCATGTGTCTTAGG + Intergenic
1151722970 17:75868700-75868722 AGCAAGACCCCATCTCTATTTGG + Intergenic
1153316444 18:3727262-3727284 GGGCAGACCCCATGTGTGTTTGG + Intronic
1153368868 18:4290819-4290841 AGATAGACCACATGTGGGTTTGG - Intronic
1154206854 18:12344843-12344865 AGCCACACACCCTGTGTTTTGGG + Intronic
1154449673 18:14463834-14463856 AACCAGGCCCCATCTTTGTTTGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1162787712 19:13046006-13046028 AACCAGGCCAGATGTGTGTTGGG - Intronic
1163391974 19:17036620-17036642 AGACAGACCCCAGGTGAGCTGGG - Intergenic
1165738364 19:38191832-38191854 AGACAGACCCCCTGTGTGAGGGG - Intronic
926635224 2:15171240-15171262 AGCCAGACCTCAGGTGCCTTGGG - Intronic
929814502 2:45220350-45220372 AGCCACACCCCATGTCTGCATGG + Intergenic
931236228 2:60414506-60414528 ATCCAGGCCCCATGGCTGTTGGG + Intergenic
932601683 2:73131520-73131542 AGCAAGACCCCATCTGTGTGTGG + Intronic
933013615 2:77094664-77094686 ACCTTGACCCAATGTGTGTTTGG - Intronic
933616521 2:84487471-84487493 AGCCAGACTCCATGTGGCTAGGG - Intergenic
938048025 2:128140572-128140594 AGCCAGGCTCCATGTCTCTTGGG + Intronic
939507677 2:143069532-143069554 AGGCAAACTCCATGTGTTTTAGG + Intergenic
1173054176 20:39595375-39595397 AGCCAGAATCCCTGTGGGTTTGG + Intergenic
1173559952 20:43996435-43996457 AGCCAGGACTCGTGTGTGTTGGG + Intronic
1176446499 21:6826556-6826578 AACCAGGCCCCATCTTTGTTCGG - Intergenic
1176824669 21:13691586-13691608 AACCAGGCCCCATCTTTGTTCGG - Intergenic
1179040929 21:37801669-37801691 AGGCTGAGCCTATGTGTGTTGGG + Intronic
1180883311 22:19222062-19222084 AGCCGGACCCCAGCTGTGATTGG - Exonic
1182012171 22:27010199-27010221 TGCCAAACCCCAGTTGTGTTTGG + Intergenic
951746313 3:25981441-25981463 AGTCAGACTCCAGGTGTGATAGG - Intergenic
952835249 3:37596700-37596722 CCCCAGACCCCTTGTGTTTTGGG - Intronic
954169987 3:48793669-48793691 AGCAAGACCCCATCTCTGTGGGG - Intronic
954838694 3:53493848-53493870 ACCCCGCCCCCACGTGTGTTTGG - Intergenic
955921761 3:63964562-63964584 AGCCACACTTCATGTGTGTAAGG - Intronic
955966373 3:64393217-64393239 AGCCAACCCCCAGGTGTGTGAGG - Intronic
955969135 3:64419630-64419652 GGGCAGAGCCCATGTCTGTTTGG - Intronic
956627539 3:71281457-71281479 AGCCAGAATCCCTGTCTGTTTGG - Intronic
958108597 3:89109685-89109707 AGCCTCACCTCATGTATGTTTGG + Intronic
960018731 3:112924250-112924272 AGCCAAACATCATATGTGTTAGG + Intronic
961448150 3:126990737-126990759 AGGCAGGGCCCATGTGTGCTTGG + Intronic
963266205 3:143242545-143242567 ACCCAGGCCCCATGTATCTTAGG + Intergenic
963569446 3:146973975-146973997 AACAAGACCCCATATGTTTTTGG + Intergenic
968803454 4:2757409-2757431 GGAAAGACCCCATGTGTGCTTGG - Intergenic
969942753 4:10750929-10750951 AGCCAAACTCTGTGTGTGTTTGG + Intergenic
970865589 4:20755425-20755447 AGCCAGCCACCATGTGAGGTGGG + Intronic
972264223 4:37443627-37443649 TGCAAGATCCCATGTTTGTTGGG - Exonic
973189256 4:47368307-47368329 GGCCTGAGCCCATGGGTGTTGGG - Intronic
983209580 4:164945152-164945174 AGTCAGACCCCATCTGAGTTAGG - Intergenic
989138870 5:38182371-38182393 ATTCAGAGCCCATGTGTATTGGG + Intergenic
991958308 5:72017413-72017435 AGCCAAACCCCATGGGGGATGGG + Intergenic
993321561 5:86474960-86474982 AGCCACACCACCTGTTTGTTGGG + Intergenic
997893611 5:137696274-137696296 TGCCAGACCCACTGTGTGATTGG - Intronic
1002578873 5:180195134-180195156 AGTCAGGCCACGTGTGTGTTTGG - Intronic
1007275338 6:40669174-40669196 AGCCAGATGCCAAGTCTGTTTGG + Intergenic
1012238062 6:96840377-96840399 AGCAAAAGCACATGTGTGTTAGG - Intergenic
1019422798 7:958838-958860 CTCCAGACCCCATCTCTGTTTGG - Intronic
1019434987 7:1017906-1017928 AGGAACACCCCATGTTTGTTCGG + Intronic
1019892407 7:3956737-3956759 AGCCAGGGACCATCTGTGTTTGG - Intronic
1027508545 7:79050193-79050215 AGCCAGCCCCCACGTGTGCATGG - Intronic
1036692637 8:10953550-10953572 GGCAAGACCCCGTCTGTGTTAGG - Intronic
1040850565 8:51897965-51897987 AGCCAGTCTCCAAGTGTGGTGGG - Intronic
1042363496 8:67909264-67909286 TGCCTTAGCCCATGTGTGTTGGG + Intergenic
1043284393 8:78511617-78511639 AGCCAGAGGCCCTGTGTGCTGGG - Intergenic
1046583946 8:116128331-116128353 AGCCAGAATCCATGAGTGTGTGG + Intergenic
1048564754 8:135583756-135583778 AGACAGACAACATGTGTGTCTGG - Intronic
1050852040 9:10300443-10300465 AGCCAGACCACTTGTGTCTCTGG - Intronic
1051818170 9:21133983-21134005 ACCCAGACCCCATTTATCTTTGG + Intergenic
1062191864 9:135252020-135252042 AGTAAGACCTCATGTGTATTGGG - Intergenic
1203522691 Un_GL000213v1:57975-57997 AACCAGGCCCCATCTTTGTTCGG + Intergenic
1187282508 X:17868696-17868718 AGCCAGACCACCAGTGTGTTGGG + Intergenic
1192808265 X:74528698-74528720 AGCCAGAGCCCATTTTTGTGGGG - Intronic
1198841883 X:140865732-140865754 TGGCACACCCCATGAGTGTTGGG + Intergenic