ID: 1132623321

View in Genome Browser
Species Human (GRCh38)
Location 16:878622-878644
Sequence GGCGCCCATGGTTGTTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132623321_1132623325 -4 Left 1132623321 16:878622-878644 CCCGGCCAACAACCATGGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 82
Right 1132623325 16:878641-878663 CGCCCCCACGTGCACCAACGTGG 0: 1
1: 0
2: 0
3: 4
4: 39
1132623321_1132623332 20 Left 1132623321 16:878622-878644 CCCGGCCAACAACCATGGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 82
Right 1132623332 16:878665-878687 GTGGCACCCGTGCCTGCTGACGG 0: 1
1: 0
2: 0
3: 14
4: 164
1132623321_1132623330 1 Left 1132623321 16:878622-878644 CCCGGCCAACAACCATGGGCGCC 0: 1
1: 0
2: 1
3: 4
4: 82
Right 1132623330 16:878646-878668 CCACGTGCACCAACGTGGCGTGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132623321 Original CRISPR GGCGCCCATGGTTGTTGGCC GGG (reversed) Intronic