ID: 1132624524

View in Genome Browser
Species Human (GRCh38)
Location 16:885174-885196
Sequence GGTGAGCTGTGATGGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132624524 Original CRISPR GGTGAGCTGTGATGGATTAA AGG Intronic
900819622 1:4876592-4876614 GGTGAGCTGAGATGTGTTGATGG + Intergenic
905611305 1:39354330-39354352 GGTGAGTGGTGGTGAATTAAGGG - Intronic
908066202 1:60407781-60407803 TGCAAGCTGTGATGGATAAACGG + Intergenic
908858572 1:68456638-68456660 GGTCAGCCGTATTGGATTAATGG + Intergenic
909195422 1:72615480-72615502 GTTGAGGGGTGATGGGTTAAGGG + Intergenic
915561551 1:156691107-156691129 GGTGGGCTGCGATGGACTTAGGG + Intergenic
920453803 1:206082136-206082158 AGTGAGCTGTGATACATCAACGG + Intronic
922171786 1:223161776-223161798 GGTGAGCTGTGATGGCTGCAGGG - Intergenic
923918525 1:238536766-238536788 GGTGCTTTGTGATGGAATAAGGG - Intergenic
1065798760 10:29331879-29331901 GGTGACCTGTGTTGGTTTCAGGG - Intergenic
1067004951 10:42651772-42651794 AGTCAGCTGTGATGGATCTAAGG - Intergenic
1071102405 10:82054366-82054388 GGTAAGGTGTGATGGAGGAAAGG + Intronic
1075623900 10:123948115-123948137 ACTGAGCTGTGAAGGATGAATGG - Intergenic
1077523610 11:3050749-3050771 GCAGAGCTGTGAAGGATTAAGGG - Intronic
1080870848 11:36235741-36235763 GGGGAGCTGTGATGAAATATTGG + Intergenic
1082243723 11:49895838-49895860 GGTAGGCTGTGATAGATAAAAGG - Intergenic
1084457984 11:69279409-69279431 GGTGTGTGTTGATGGATTAATGG - Intergenic
1084777510 11:71387216-71387238 GGTGAGATGGGAAGGATTCAGGG + Intergenic
1086819476 11:91417336-91417358 GGAGTGGTGTGATGGATAAAAGG + Intergenic
1087655843 11:100922003-100922025 GGTGAGCTGAGAGGGCATAAGGG + Intronic
1089286998 11:117413854-117413876 GGAGAGCTGTGAAGGAGCAAAGG - Intergenic
1089317213 11:117600359-117600381 GCTGAGCTGGGATGCATAAAGGG + Intronic
1095404511 12:41853251-41853273 GGTGAGCTGAGCTGGATAAGTGG + Intergenic
1096483109 12:51956286-51956308 GGTGTGATGTTATGGTTTAAAGG - Intronic
1096539415 12:52296593-52296615 GGTGAGTTCTGATGGATAATTGG + Intronic
1098813806 12:75130862-75130884 AGTGAGCTGATATGGATTACAGG - Intronic
1099337733 12:81385710-81385732 GGATAGCTGTGATGAGTTAATGG + Intronic
1102528795 12:113531150-113531172 GGTGAGAGGTGATGGAATCATGG + Intergenic
1104071971 12:125353720-125353742 AGTGAGCTGTGGGGGATGAAGGG - Intronic
1104327067 12:127809384-127809406 AGTGAACTGTGATGGATTTCTGG + Intergenic
1104616575 12:130275160-130275182 TGTGATCTGTGTTGAATTAAGGG + Intergenic
1106773366 13:32984457-32984479 GGTGGCCTGTGATGCATTCATGG + Intergenic
1107754972 13:43611222-43611244 GGTGAGCAGAGCTGGATTAAGGG - Intronic
1108092638 13:46865329-46865351 GCTGAGCTGTTAGGGATTTAAGG + Intronic
1108270818 13:48757757-48757779 GGTGAGCTGTGGTGGGGGAAGGG - Intergenic
1113509870 13:110844857-110844879 GTTGATCTGTGATGGGTTGAGGG - Intergenic
1114046784 14:18882311-18882333 GCTGAGCTGGGAGGGAGTAAAGG - Intergenic
1114117429 14:19637135-19637157 GCTGAGCTGGGAGGGAGTAAAGG + Intergenic
1119766865 14:77195897-77195919 GGGGAGCTGTGATGGGGTGAGGG - Intronic
1119770726 14:77219351-77219373 GGTGAGCTCTGTTGGAGTAGGGG - Intronic
1120528155 14:85601497-85601519 GGCAAGCTGCAATGGATTAATGG + Intronic
1122162761 14:99797670-99797692 GGTGAGCTGTGATTGATCAAAGG - Intronic
1122520347 14:102339317-102339339 GGTGACCTGTGCTGGATTTAAGG + Intronic
1123180815 14:106468521-106468543 GCTGAGGTGTGATAGATCAATGG + Intergenic
1202899487 14_GL000194v1_random:27219-27241 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1202946082 14_KI270726v1_random:28137-28159 GCTGAGGTGTGATAGATCAATGG - Intergenic
1126963782 15:54028417-54028439 GCTGAGACGTGATGGATTAGTGG - Intronic
1129920632 15:79316423-79316445 GGTGATCTAGGAAGGATTAAAGG + Intronic
1130653264 15:85774249-85774271 CCTGAGCTTTGATGGATTTAAGG + Intronic
1132361572 15:101220497-101220519 GGTGAGAAGTGGTGGATAAATGG - Intronic
1132624524 16:885174-885196 GGTGAGCTGTGATGGATTAAAGG + Intronic
1136599077 16:31272042-31272064 GCTGGGCTTTGATGGATGAAGGG + Intronic
1139415085 16:66801549-66801571 GGTGAGCGGTGATGAAGAAAGGG - Exonic
1140184158 16:72751741-72751763 GGTGAACTGTGGTGGATGATGGG + Intergenic
1141914333 16:87084180-87084202 GGTGAGCTTGGATGGAAGAAGGG + Intronic
1142350913 16:89579561-89579583 GGTGAGATGTGATGGCTGACGGG - Intronic
1142350923 16:89579623-89579645 GGTGAGATGTGATGGGTGATGGG - Intronic
1143273126 17:5690171-5690193 AGTGAGCTGTGTGGGATTCATGG + Intergenic
1144218868 17:13081884-13081906 GGTGAGTTGTGATGTCTAAAAGG - Intergenic
1144391788 17:14800367-14800389 AGGGAGCTGTGATGGGTGAAGGG + Intergenic
1144640991 17:16936410-16936432 GGTTGGCTGTGATTAATTAAAGG + Intronic
1144874091 17:18388107-18388129 GGTTGGCTGTGATTAATTAAAGG - Intronic
1145158129 17:20556309-20556331 GGTTGGCTGTGATTAATTAAAGG + Intergenic
1148813524 17:50310476-50310498 GGTGAGGTGTGATGGCTTGTGGG - Intergenic
1149529093 17:57380592-57380614 GGTGAAATGTGCTGGACTAAAGG + Intronic
1150500262 17:65643867-65643889 GCTCAGCTGTGTTGGATTCAGGG + Intronic
1150946752 17:69754979-69755001 GGTGAGGTGTCCTGGTTTAATGG - Intergenic
1153395053 18:4610026-4610048 GGTGAGCTTTTATGGTTAAAAGG + Intergenic
1154124781 18:11681295-11681317 TATGAGCTGTGATGGATTGAAGG - Intergenic
1155326383 18:24669117-24669139 GGTGAGCTGGGGTGGAGTGAGGG + Intergenic
1156360245 18:36378389-36378411 TGGGAGCTGTGACAGATTAATGG - Intronic
1156433811 18:37104520-37104542 GGTGAGGAGTGATTGATGAATGG + Intronic
1157199788 18:45650408-45650430 GCCCATCTGTGATGGATTAAGGG - Intronic
1163828053 19:19534884-19534906 GGTGAGCTGTTCTGGATGAGGGG - Intronic
1165615244 19:37193727-37193749 GGTGTGCAGTGGTGCATTAACGG - Intronic
1202647965 1_KI270706v1_random:158415-158437 GGTGAGCTGTGAGGGAGGAGAGG + Intergenic
925167178 2:1723531-1723553 GTTGAGTTGTTATGGATGAATGG + Intronic
928373331 2:30756872-30756894 GGTAAGCGGAGATGGAATAAGGG - Intronic
932389424 2:71372520-71372542 GGTGTGCTGTCAGGGATTTAAGG + Intronic
934752132 2:96800118-96800140 GGTCAGCTCCGATGGAATAAAGG + Intronic
934990420 2:98916556-98916578 GGTTAGCTGTGATAGAATTATGG - Intronic
938266575 2:129932590-129932612 GCTGAGCTGGGAGGGAGTAAAGG + Intergenic
940180078 2:150922304-150922326 AGAGAGCGGTGATGGAATAAGGG - Intergenic
942121495 2:172782300-172782322 GGTGGGCTGGGAGGGATAAAAGG + Intronic
942650112 2:178157673-178157695 GTGGAGCCGTGATGGATTGATGG - Intergenic
945809397 2:214530191-214530213 GGTGAGCTGTGAAGGAGAGAAGG - Intronic
946565773 2:220963800-220963822 GGTGGGCTGTGCTAGATCAAAGG - Intergenic
947754944 2:232555309-232555331 GAAGATCTGTGATGAATTAATGG + Intronic
1170809991 20:19666598-19666620 GGGGAACTTTAATGGATTAATGG - Intronic
1172930201 20:38581060-38581082 GGAGAGCTGTTCTGGATGAAAGG - Intergenic
1173976241 20:47188792-47188814 GGTGCTTTGTGATGGATAAAAGG + Exonic
1174517062 20:51100770-51100792 GGTGAATTGTGATTGATTTAAGG + Intergenic
1176603882 21:8814314-8814336 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1176618863 21:9041991-9042013 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1176718735 21:10376609-10376631 GATGAGCTTTGAAGGATTCATGG + Intergenic
1176982162 21:15395720-15395742 GTTGAGGTGTCATGGATAAAAGG + Intergenic
1178479335 21:32966171-32966193 GAGGAGCTGTGATAGATTGAAGG - Intergenic
1180299960 22:11029503-11029525 GATGAGCTTTGAAGGATTCATGG + Intergenic
1180346166 22:11705891-11705913 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1180353938 22:11824048-11824070 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1180384309 22:12168277-12168299 GGTGAGCTGTGAGGGAGGAGAGG + Intergenic
1180465320 22:15604950-15604972 GCTGAGCTGGGAGGGACTAAAGG - Intergenic
1181761033 22:25058981-25059003 GGGGTGCTGTGAGGGAATAATGG - Intronic
1182108279 22:27704650-27704672 GGTGAGCTGTGATGGGTCCTAGG + Intergenic
1184008575 22:41729500-41729522 GGAGAGCAGTTATGGATTATGGG - Intronic
1184557848 22:45242633-45242655 GGTGAGCAGTGAGGGAATGAAGG + Intergenic
949240005 3:1859566-1859588 GGTGAGAGGTGATGGAATCATGG + Intergenic
952499085 3:33942581-33942603 GCTGAGCTGGGCTGGACTAATGG + Intergenic
959434707 3:106300193-106300215 GGTGACCTGTGTTGGTTTATAGG + Intergenic
960234928 3:115271122-115271144 GGTGAGCTCTGACGGAAGAAAGG + Intergenic
967578855 3:191127774-191127796 GGTGAACTGGGATGGAATATTGG - Intergenic
969038843 4:4277776-4277798 GGTGAACTGTGATGGGGTAGAGG + Intronic
973374234 4:49276601-49276623 GGTGAGCTGTGAGGGAGGAGAGG + Intergenic
973383178 4:49333638-49333660 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
973386787 4:49518653-49518675 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
978075799 4:104528098-104528120 GGGGAGCTATGAAGGATGAAGGG + Intergenic
980580811 4:134747490-134747512 TGTGAGCTTTGATGGCTGAATGG + Intergenic
980581607 4:134761719-134761741 GGGGAGCTGTCAAGGATTTAGGG - Intergenic
985103011 4:186476507-186476529 GGAGAGCTGTGATCGATGAATGG - Intronic
985103017 4:186476563-186476585 GGAGAGCTGTGATCGATGAGTGG - Intronic
985103020 4:186476591-186476613 GGAGAGCTGTGATCGATGAATGG - Intronic
985103042 4:186476787-186476809 GGAGAGCTGTGATCAATGAATGG - Intronic
985103045 4:186476815-186476837 GGAGAGCTGTGATCGATGAATGG - Intronic
985103048 4:186476843-186476865 GGAGAGCTGTGATCGATGAATGG - Intronic
985103053 4:186476871-186476893 GGAGAGCTTTGATCGATGAATGG - Intronic
985103056 4:186476899-186476921 GGAGAGCTGTGATCAATGAATGG - Intronic
985103069 4:186476983-186477005 GGAGAGCTGTGATCGATGAATGG - Intronic
985103097 4:186477207-186477229 GGAGAGCTGTGATCAATGAATGG - Intronic
985103105 4:186477263-186477285 GGAGAGCTGTGATCAATGAATGG - Intronic
985103124 4:186477403-186477425 GGAGAGCTGTGATCAATGAATGG - Intronic
985103127 4:186477431-186477453 GGAGAGCTGTGATCAATGAATGG - Intronic
985103130 4:186477459-186477481 GGAGAGCTGTGATCAATGAATGG - Intronic
985103135 4:186477487-186477509 GGAGAGCTGTGATCAATGAATGG - Intronic
985103143 4:186477543-186477565 GGAGAGCTGTGATCGATGAATGG - Intronic
985103160 4:186477683-186477705 GGAGAGCTGTGATCAATGAATGG - Intronic
985103165 4:186477711-186477733 GGAGAGCTGTGATCGATGAATGG - Intronic
985103173 4:186477767-186477789 GGAGAGCTGTGATCGATGAATGG - Intronic
985103190 4:186477907-186477929 GGAGAGCTGTGATCAATGAATGG - Intronic
985103192 4:186477935-186477957 GGAGAGCTGTGATCAATGAATGG - Intronic
985103195 4:186477963-186477985 GGAGAGCTGTGATCAATGAATGG - Intronic
985103200 4:186477991-186478013 GGACAGCTGTGATCGATGAATGG - Intronic
985103205 4:186478019-186478041 GGAGAGCTGTGATCGATGAATGG - Intronic
985103208 4:186478047-186478069 GGAGAGCTGTGATCAATGAATGG - Intronic
985103216 4:186478103-186478125 GGAGAGCTGTGATCAATGAATGG - Intronic
985103219 4:186478131-186478153 GGACAGCTGTGATCGATGAATGG - Intronic
985103224 4:186478159-186478181 GGAGAGCTGTGATCAATGAATGG - Intronic
985103227 4:186478187-186478209 GGAGAGCTGTGATCGATGAATGG - Intronic
985103230 4:186478215-186478237 GGACAGCTGTGATCGATGAATGG - Intronic
985103235 4:186478243-186478265 GGAGAGCTGTGATCAATGAATGG - Intronic
985103243 4:186478299-186478321 GGAGAGCTGTGATCGATGAATGG - Intronic
985103254 4:186478383-186478405 GGAGAGCTGTGATCGATGAATGG - Intronic
985103260 4:186478439-186478461 GGAGAGCTGTGATCAATGAATGG - Intronic
985103263 4:186478467-186478489 GGAGAGCTGTGATCAATGAATGG - Intronic
985103271 4:186478551-186478573 GGAGAGCTGTGATCGATGAATGG - Intronic
985103285 4:186478663-186478685 GGAGAGCTGTGATCAATGAATGG - Intronic
985103288 4:186478691-186478713 GGAGAGCTGTGATCAATGAATGG - Intronic
985103293 4:186478719-186478741 GGAGAGCTGTGATCAATGAATGG - Intronic
985103302 4:186478803-186478825 GGAGAGCTGTGATCAATGAATGG - Intronic
985103305 4:186478831-186478853 GGAGAGCTGTGATCAATGAATGG - Intronic
986188985 5:5475981-5476003 TGTGGCCTGTGATGGATAAATGG + Exonic
986660294 5:10053328-10053350 GGTGAGAGGTGATTGGTTAATGG - Intergenic
986737234 5:10676707-10676729 GGTGAGGTGTGATGGGTTGTGGG + Intergenic
986888918 5:12275882-12275904 GTAGAGATGTGATTGATTAAAGG - Intergenic
987529782 5:19102560-19102582 GGTGAGCAGTGAGGGGGTAAGGG - Intergenic
993349169 5:86825403-86825425 GGTGATGTGTGATGGAGTGAGGG - Intergenic
993473133 5:88331192-88331214 GGTGTGCAGTGATGCAATAATGG - Intergenic
995201860 5:109434048-109434070 GGTGAACTGTGAGAGGTTAAGGG + Intergenic
997235746 5:132271139-132271161 GGTGAGATTTGAGGGATCAAGGG - Intronic
997954859 5:138271372-138271394 TTTGAGCAGTGATGGATTTAGGG + Intronic
998404790 5:141868226-141868248 GGTGAGCTGAGTTGGAACAAAGG - Intronic
1000749343 5:165074746-165074768 GGTGAGGAGGGATGGATTATCGG + Intergenic
1000796626 5:165672277-165672299 AGTGAGCTGTGATGGCATCATGG - Intergenic
1003444797 6:6174667-6174689 GATAAGCTGTGATGGTGTAACGG + Exonic
1004522732 6:16377572-16377594 AGTGAGCTGTGATGGTTTCTTGG - Intronic
1004549626 6:16634180-16634202 GGTTAGTTTAGATGGATTAAGGG - Intronic
1006490449 6:34382778-34382800 GGTGTGCTGTGATGCAGTCATGG - Intronic
1008168687 6:48174360-48174382 GGGGAACTGTTATGCATTAAAGG - Intergenic
1011861729 6:91766084-91766106 GGTGAGCAGAGATGGGTCAAAGG + Intergenic
1012532074 6:100250216-100250238 GGTGAGTCCTGATGAATTAACGG - Intergenic
1013374521 6:109501517-109501539 GGAGGGCTGTGATTGCTTAAAGG - Intronic
1013895967 6:115088574-115088596 GGTGAGATGTGATTGGATAATGG - Intergenic
1014322722 6:119951498-119951520 GGTGGCCTGAGATGGCTTAAAGG + Intergenic
1018346642 6:162905730-162905752 GTTGAGCTGTGGTGGATTGGTGG + Intronic
1018585738 6:165356144-165356166 GGTGAGCGGTGATTGAGTCATGG - Intronic
1020194664 7:6027736-6027758 GGTGAACAGTGATGTTTTAAAGG + Intronic
1021181478 7:17510958-17510980 GGATGGCTGTGATGGATCAAGGG + Intergenic
1021653980 7:22856649-22856671 CTTCTGCTGTGATGGATTAAAGG + Intergenic
1022095825 7:27140614-27140636 GGGGTGCTGGGATGGGTTAAGGG + Intronic
1025307583 7:57877473-57877495 GGAGAGCTGGGATGGAATAGGGG + Intergenic
1026448022 7:70502481-70502503 AGTGAACTGTGATGGAATCAAGG + Intronic
1026449215 7:70512591-70512613 GGTGAGCTTTAAAGGACTAAAGG + Intronic
1031192700 7:118574999-118575021 GGGGAGCTGTGATGATTTGAAGG + Intergenic
1036814383 8:11890360-11890382 GGTGGGCAGTGATTGAATAATGG + Intergenic
1039358794 8:36851276-36851298 GGTGAGAGGTGATTGATTATGGG + Intronic
1041368039 8:57130064-57130086 GGAGAGAGGTGATGGACTAAAGG + Intergenic
1041376974 8:57215327-57215349 GATGAGCTGGGAAGGATTCAAGG + Intergenic
1041519315 8:58737843-58737865 AGTGAGCTGAGATGGTTCAAAGG - Intergenic
1045555447 8:103210259-103210281 GGGGTGCTGTGATGGATTCAAGG - Intronic
1047733461 8:127745792-127745814 GCTGAGGGGTTATGGATTAATGG + Intergenic
1048476572 8:134747684-134747706 GGTCAGCTGTGATGGAATCTAGG + Intergenic
1048942580 8:139414518-139414540 TGTCAGCTGGGATGGATTTAGGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1052742487 9:32406666-32406688 GGTGAGATGTGATGACTTAAGGG + Intronic
1055678783 9:78693096-78693118 GGAGAGCTGTCATGGATTCCTGG - Intergenic
1056834013 9:89939970-89939992 GGTGAGCTGTGAAGACTTTAGGG - Intergenic
1056834351 9:89942585-89942607 GGTGAGCTGTGAAGACTTGATGG - Intergenic
1057207141 9:93180432-93180454 ACTCAGCTGTGATGGATGAATGG - Intergenic
1057303020 9:93897240-93897262 GGTGAGCTGTGCAGGAGTAGAGG + Intergenic
1058910591 9:109516925-109516947 GGTGAGCAGGGATGGAATAGGGG + Intergenic
1203551299 Un_KI270743v1:166474-166496 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1191710856 X:64148998-64149020 GGTGAGAGGTGATGGAATCATGG - Intergenic
1191877241 X:65809361-65809383 GCTGAGCAGTGATGGTTTACAGG + Intergenic
1193036613 X:76958039-76958061 GGTGAGCTGCTATGCATTGATGG + Intergenic
1194734414 X:97495125-97495147 GCTGAGCTGTGATGGCTTGGGGG + Intronic
1198145060 X:133847542-133847564 GGAGAGCTGTCATGGAAAAAAGG - Intronic
1200232781 X:154452581-154452603 GGTGAGCTGGGCTGGAACAAGGG + Intergenic
1201152572 Y:11102081-11102103 GGTGAGCTGTGAGGGAGGAGAGG - Intergenic
1201306223 Y:12552900-12552922 GGTGAGCTGTGTGGTATGAAGGG - Intergenic