ID: 1132626018

View in Genome Browser
Species Human (GRCh38)
Location 16:891928-891950
Sequence CCGTCAGCTGAACCTGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132626013_1132626018 25 Left 1132626013 16:891880-891902 CCATCCAGCCAAAGAGCTGAGAG 0: 1
1: 1
2: 2
3: 25
4: 296
Right 1132626018 16:891928-891950 CCGTCAGCTGAACCTGCTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 99
1132626015_1132626018 17 Left 1132626015 16:891888-891910 CCAAAGAGCTGAGAGTGTTTACT 0: 1
1: 0
2: 2
3: 27
4: 252
Right 1132626018 16:891928-891950 CCGTCAGCTGAACCTGCTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 99
1132626014_1132626018 21 Left 1132626014 16:891884-891906 CCAGCCAAAGAGCTGAGAGTGTT 0: 1
1: 0
2: 2
3: 30
4: 461
Right 1132626018 16:891928-891950 CCGTCAGCTGAACCTGCTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132626018 Original CRISPR CCGTCAGCTGAACCTGCTCT CGG Intronic