ID: 1132626838

View in Genome Browser
Species Human (GRCh38)
Location 16:895266-895288
Sequence AGCCCGAGGCTGACCCGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132626838_1132626846 16 Left 1132626838 16:895266-895288 CCTGGTCGGGTCAGCCTCGGGCT 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1132626846 16:895305-895327 TCCCCAGGTCAGCCCATCACGGG 0: 1
1: 0
2: 0
3: 27
4: 214
1132626838_1132626845 15 Left 1132626838 16:895266-895288 CCTGGTCGGGTCAGCCTCGGGCT 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1132626845 16:895304-895326 CTCCCCAGGTCAGCCCATCACGG 0: 1
1: 0
2: 1
3: 21
4: 212
1132626838_1132626842 1 Left 1132626838 16:895266-895288 CCTGGTCGGGTCAGCCTCGGGCT 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1132626842 16:895290-895312 CCAGTAGAATCCTCCTCCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132626838 Original CRISPR AGCCCGAGGCTGACCCGACC AGG (reversed) Intronic
900298936 1:1967175-1967197 AGCCCCAGGCTGACCCCAGGAGG + Intronic
901080682 1:6582110-6582132 AGCCTGAGGCTGTGCTGACCAGG + Exonic
912404541 1:109426180-109426202 AACCCGAGACTGGCCGGACCTGG - Intronic
1063243567 10:4195252-4195274 AGCCCAGCGCTGACCCGAGCAGG + Intergenic
1066758076 10:38730362-38730384 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1067068662 10:43117438-43117460 AGCCCCAGGCTGCCCACACCTGG + Intronic
1075791126 10:125085018-125085040 AACCCAAAGATGACCCGACCTGG + Intronic
1077233302 11:1468302-1468324 AGCCAGAGGGTGGCCCCACCAGG + Intergenic
1083625202 11:64068842-64068864 AGGCCGAGGCTCACTCAACCAGG - Intronic
1102645497 12:114400982-114401004 AGCCAGAGGATGCCCCGAGCAGG - Intronic
1103348465 12:120266177-120266199 AGCCCGTGGCTGACCTTTCCTGG + Intergenic
1122540111 14:102493378-102493400 AGGCCGAGGCTGAGGCCACCAGG - Intronic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123441479 15:20295095-20295117 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1124632536 15:31345722-31345744 AGCCTGAGACTGACCACACCAGG + Intronic
1125504142 15:40257281-40257303 AGCCCAACGCTGACCCCTCCGGG + Intronic
1125762203 15:42104284-42104306 AGCCAGGGCCTGCCCCGACCTGG + Intergenic
1128309709 15:66622415-66622437 AGCCCGCGGCCGACCCCGCCTGG + Intronic
1130936300 15:88473714-88473736 AGCCCGGGGCTGACTCCAGCAGG + Intronic
1132626838 16:895266-895288 AGCCCGAGGCTGACCCGACCAGG - Intronic
1135435726 16:22425549-22425571 AGCCCGAGGGTGACCCCGCCTGG - Intronic
1136358305 16:29761103-29761125 ATCCCTAGGCTCTCCCGACCTGG + Intergenic
1136724765 16:32348824-32348846 AGCTCGAGGCGGACGCGGCCCGG - Intergenic
1136843091 16:33554864-33554886 AGCTCGAGGCGGACGCGGCCCGG - Intergenic
1137057703 16:35753364-35753386 AGCCCCAGCCAGACCCGACCCGG - Intergenic
1138604676 16:58081250-58081272 AGCCCCAAGCTGACCCTCCCTGG - Intergenic
1139613296 16:68074215-68074237 AGCCCTAAGCTGACTCCACCAGG + Intronic
1141206661 16:81938172-81938194 GGCCAGAGGCTGACCTCACCAGG - Intronic
1142044933 16:87919353-87919375 AGCCCGAGGGTGACCCCGCCTGG - Intronic
1203001665 16_KI270728v1_random:168931-168953 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1203133269 16_KI270728v1_random:1705337-1705359 AGCTCGAGGCGGACGCGGCCCGG + Intergenic
1203153256 16_KI270728v1_random:1855162-1855184 AGCTCGAGGCGGACGCGGCCCGG - Intergenic
1144668282 17:17116774-17116796 AGCCCCAGGCTGACAGCACCTGG - Intronic
1144763354 17:17719956-17719978 AGCGTGAGGCTTACCAGACCAGG + Intronic
1150285307 17:63950725-63950747 AGGCTGAGGCTGACCCTGCCTGG - Intronic
1152663234 17:81552558-81552580 AGGTCGAGGTTGACCCGGCCGGG + Intronic
1152903566 17:82958459-82958481 ATCCCGAGGCTGAACCCACGAGG - Intronic
1153489185 18:5630230-5630252 GGGGCGAGGCTGGCCCGACCGGG - Intronic
1157290552 18:46406612-46406634 GGCCCCAGGCTGACTCTACCTGG + Intronic
1160895770 19:1401225-1401247 AGGCCGGGGCTGCCCCGACCCGG - Intronic
1161657880 19:5526879-5526901 AGCCCCAGCCAGAGCCGACCCGG - Intergenic
1164709158 19:30343081-30343103 GGCCCAAGGCTGTCCCCACCGGG - Intronic
1168097886 19:54125811-54125833 AGCCCCAGGCCCACCCGTCCTGG - Intronic
925744059 2:7029888-7029910 AGCCCGAGGCTGTGCTGTCCAGG + Intronic
926688740 2:15718278-15718300 ACCCCGAGGCTGGCCCCAGCAGG - Intronic
934321393 2:91974802-91974824 AGCTCGAGGCCGACGCGGCCAGG + Intergenic
948563390 2:238868335-238868357 AGCCCGACGCTTACCAGAGCAGG - Intronic
1175899581 20:62354752-62354774 AGCCCTAGGCTCCCCCTACCTGG + Intronic
1175936440 20:62516389-62516411 AGCCCGAGTCTGCCCCATCCTGG + Intergenic
1179783911 21:43719207-43719229 AGCCCGAGCCCGAGCCGAGCCGG + Exonic
1180988095 22:19917447-19917469 AGCCCCAGGAAGACCCGCCCTGG + Intronic
1182211327 22:28679735-28679757 AGCTCGAGGCGGACGCGGCCCGG - Exonic
1184896661 22:47411252-47411274 AGGCCGATGCTGATCCAACCAGG - Intergenic
953901346 3:46845817-46845839 ACCTCGAGGCTGCGCCGACCAGG + Intergenic
954879333 3:53823172-53823194 AGACTGAGGCTGGCACGACCGGG - Intronic
959592066 3:108091595-108091617 AGCCCGAGGCCGCCACGCCCAGG + Intergenic
959919983 3:111859478-111859500 GGCCCGAGGGGGACCCGACGGGG + Exonic
967055289 3:185824977-185824999 AGCCCGCGGCTCCCCCGGCCCGG + Exonic
980991821 4:139744841-139744863 AGAGCCAGGCTGACCAGACCCGG + Intronic
986264693 5:6181642-6181664 ATCCCAGGGCTGACCCGACAGGG + Intergenic
997677755 5:135726103-135726125 AGCCAGAGTCTGGCCCTACCAGG + Intergenic
1001470282 5:172006935-172006957 AGCCCAAGGCTGCCCAGACCGGG + Intergenic
1001634056 5:173197210-173197232 GGCCCGTGGCTGACCAGTCCTGG - Intergenic
1001653161 5:173329447-173329469 AGCCGGGGGCTATCCCGACCCGG - Exonic
1004842456 6:19602883-19602905 AGACCAAGGCTGACACTACCTGG + Intergenic
1006794372 6:36722374-36722396 AGCCCCAGGCTGAGCCCCCCTGG - Exonic
1008880936 6:56379405-56379427 AGCCTGAGGCTGATCCGAAATGG + Intronic
1020224823 7:6272216-6272238 AGCCCGCGGCAGCCCCGGCCTGG + Intronic
1021311836 7:19106629-19106651 GGCCGGAGGCTGACACCACCAGG + Intronic
1023243820 7:38178730-38178752 AGCCCGGGGCCGACCCCACCGGG - Intronic
1029115218 7:98233222-98233244 AGCCCGAGGCTGTCAGGACCTGG - Intronic
1030304341 7:108003358-108003380 ACCCCGGGGCGGACCCGCCCTGG - Intergenic
1031134921 7:117873641-117873663 AGCCCGCGGCTGGCGCCACCGGG - Intronic
1032240310 7:130154477-130154499 GGCCCGAGGCTGACACAAGCCGG + Intergenic
1035326212 7:158067796-158067818 CGGCCCAGCCTGACCCGACCCGG - Intronic
1035682062 8:1495432-1495454 AGCCGGAGACTGAGCCGGCCAGG + Intergenic
1038554222 8:28494873-28494895 GGCCCGAAGCTGACCCGAGCCGG - Intronic
1049340298 8:142108822-142108844 GGCCCGAGGCTGACCCTGCTGGG + Intergenic
1049580191 8:143407533-143407555 TGCCCGGGGCTGCCCCGACCTGG - Intergenic
1056558259 9:87707357-87707379 AGCCAGAGGCTGCCCTCACCGGG - Exonic
1057028639 9:91756558-91756580 GGCCCGAGGCTGACCTGGCTGGG - Intronic
1060270234 9:122135050-122135072 AGCCCAAGGCTGACTCAACAGGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062733468 9:138121652-138121674 AGCCCACGGCTGAGCCGGCCTGG - Exonic
1192227317 X:69238320-69238342 AACCCCAGGCTGAGCCGAGCAGG + Intergenic
1200224902 X:154411965-154411987 AGGCCGAGGCAGGCCCGCCCGGG + Exonic