ID: 1132629396

View in Genome Browser
Species Human (GRCh38)
Location 16:909715-909737
Sequence CGCAGCTGCCCCGGGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132629384_1132629396 18 Left 1132629384 16:909674-909696 CCGTGGCCAGTGCTGTCTTAGGA 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 236
1132629387_1132629396 12 Left 1132629387 16:909680-909702 CCAGTGCTGTCTTAGGACTGGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 236
1132629382_1132629396 25 Left 1132629382 16:909667-909689 CCTGAGTCCGTGGCCAGTGCTGT 0: 1
1: 0
2: 0
3: 23
4: 208
Right 1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG 0: 1
1: 0
2: 0
3: 24
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132629396 Original CRISPR CGCAGCTGCCCCGGGGGGAC AGG Intronic
900127295 1:1074181-1074203 AGCAGCTGTCCCGGTGGCACTGG + Exonic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
900359974 1:2283755-2283777 CGAAGCTGCCCCAAGGGTACGGG + Intronic
900375229 1:2351182-2351204 CACAGCTGCCCAGGGTGGCCGGG + Intronic
900589881 1:3454807-3454829 CGCAGGTGAGCCTGGGGGACAGG + Exonic
900969278 1:5980542-5980564 CGCAGCTGCCATGTGGGGGCGGG + Intronic
901022189 1:6261079-6261101 CGCTGCTGCGCCGGGCGGCCGGG + Intergenic
901317372 1:8318140-8318162 GGCAGCAGCCCAGCGGGGACAGG + Intronic
902531115 1:17091277-17091299 CCCAGCTGCCTAGGGGGGCCAGG - Intronic
902628804 1:17692614-17692636 CGCAGCTGCCCAGGTGGGAAGGG - Intronic
903550181 1:24152664-24152686 TGCAGCTGCACCTGGGGGAAGGG + Intergenic
904095136 1:27971144-27971166 ACCAGCTGCCCCAGGGGCACTGG + Exonic
905285944 1:36880528-36880550 CACAGCTGCCCTGGGGGAAGAGG - Intronic
906480955 1:46198478-46198500 CGCCGCTGCCGCGGGGTGAGAGG + Intronic
906607760 1:47183487-47183509 CCCAGCTGCCCTGTGGGCACAGG + Intergenic
907767275 1:57423864-57423886 CGCAGGTGCCCCGCGAGGACAGG - Intronic
919690784 1:200526905-200526927 CTCAGCTCCCCATGGGGGACCGG - Intergenic
920500665 1:206483037-206483059 AGCAGCTGCCCAGGAGGGCCAGG - Intronic
920788463 1:209065210-209065232 CACAGAAGCCCCGGGGGGAATGG - Intergenic
921300219 1:213744880-213744902 CTCAGCTGCCTGGGGGGAACAGG + Intergenic
922119093 1:222644508-222644530 CGCCGCTACCCCGGGGGACCCGG + Intronic
922776494 1:228216455-228216477 CGCAGCTGCCCGGGAGGTGCTGG + Exonic
923299562 1:232629478-232629500 CGCAGCTTCCCCGGCGCGCCTGG - Intergenic
1062971768 10:1653991-1654013 CACAGCTGCCCCGGGGGTCCTGG + Intronic
1063452937 10:6163651-6163673 CGCAGCTGCTCCCGGGGCCCGGG - Intronic
1064208891 10:13347560-13347582 CGCACCCGCCCCGGGTCGACAGG + Intronic
1064286988 10:14000353-14000375 CACACCTGCCCCGGGGGAAATGG - Intronic
1070490462 10:76971053-76971075 CGCTGATGCCCCTGGGTGACAGG - Intronic
1073414262 10:103368202-103368224 CGCCGCTGCCCCGGCGGGGGCGG + Exonic
1075878085 10:125824054-125824076 AGCTGCTGCCCCGAGGGGAGAGG - Intronic
1077043420 11:534417-534439 AGCAGCTGCCCTGTGGGGCCTGG - Intronic
1077409094 11:2395245-2395267 CTCAGCTGCCCCGGGAGTGCTGG - Intronic
1077536734 11:3128214-3128236 CTCATCTGCCCTGGGGGGAGTGG - Intronic
1078011248 11:7574703-7574725 CCCAGCTGCCCCTGGGGGTGGGG + Intronic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1081957697 11:47107861-47107883 CGCTGCTGCCCCAAGGGAACTGG - Intronic
1082013154 11:47464539-47464561 CGCTGCTGCCTGTGGGGGACGGG - Intergenic
1082810610 11:57476955-57476977 AGCCGCAGCCCCGGGTGGACGGG - Exonic
1083297505 11:61722988-61723010 CTCAGCAGCCCCGGGGGCACAGG + Intronic
1083419004 11:62543080-62543102 CGCTCCAGCCCCCGGGGGACCGG + Intronic
1083476991 11:62921299-62921321 CGCAGCTCCCCCTGGGAGCCAGG - Exonic
1083651452 11:64207018-64207040 GGCAGCTGCCCCTGAGGGTCTGG + Intronic
1083673932 11:64315152-64315174 GGCAGCTGGCCTGGGGGAACTGG + Exonic
1083712580 11:64558386-64558408 TGCAGCTGCCCGGGTGGGAAGGG + Intronic
1084083773 11:66845392-66845414 AGCTACTGCCCCGGGGGGAGGGG + Intronic
1084153944 11:67303646-67303668 CGCCGCTGCCCGGGGGCGAACGG - Exonic
1084858423 11:72003324-72003346 CGGAGCTGGCCCAGGGGGCCTGG - Exonic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1092260863 12:6952649-6952671 CCCAGCCGCCCCGTGGGGATGGG + Intronic
1096222971 12:49843615-49843637 TACAGTTGCCCCTGGGGGACAGG - Intergenic
1096522077 12:52190026-52190048 CCCAGCTGCCCTGGGGAGGCAGG - Intronic
1097191024 12:57219710-57219732 CGCAGCTGGGCCAGGGGGACAGG + Intronic
1097191125 12:57220164-57220186 AGCAGCTGCCCAGTGGGGATGGG + Intronic
1097281314 12:57846658-57846680 CGGAGCTGCCGCTGGGGGATCGG - Exonic
1100390028 12:94140024-94140046 CTCAGCTGCCCCAGGGGGCACGG - Intergenic
1100391080 12:94147240-94147262 CGCAGCTGCCCCGGGAAGCTGGG + Intergenic
1100844693 12:98645674-98645696 CGGACCTGCCCCGGGGCGAAGGG + Exonic
1102453015 12:113055736-113055758 CCCATCTGCCCCGGGGAGGCAGG + Intergenic
1102480713 12:113221471-113221493 CGCAGCTGCCCTGGTGGCAGTGG + Exonic
1104913164 12:132250038-132250060 CCCAGCAGCCACGGAGGGACAGG + Intronic
1104947599 12:132423557-132423579 AGCAGCGGCCCCGGGAGGGCGGG + Intergenic
1105344423 13:19560369-19560391 GGCAGCTGGCCTGGGGGAACTGG - Intergenic
1105535610 13:21261205-21261227 GGCAGCTGGCCTGGGGGAACTGG + Intergenic
1106093712 13:26623304-26623326 CTCAGCTGCCACTGGGAGACAGG + Intronic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1108727798 13:53201127-53201149 CGCCGCTGCCCTCGGGGGAGCGG + Intergenic
1111268715 13:85853310-85853332 TGCAGCTGCACCTGGGAGACAGG - Intergenic
1111354574 13:87080746-87080768 AGCAGCTGCCGCGGTGGGAGAGG - Intergenic
1111672449 13:91348029-91348051 CGGAGCGGCCCGGGGCGGACTGG + Intergenic
1111823695 13:93243542-93243564 CGCACCTGCCACTGGGAGACCGG - Intronic
1114031530 14:18584240-18584262 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1115474482 14:33800380-33800402 CGCCGCCGCCCTGCGGGGACGGG - Exonic
1118389008 14:65280814-65280836 TGCAGCTGCCCCGCGAGGGCCGG + Intergenic
1118749434 14:68795458-68795480 AGCCGGTGCCCCGCGGGGACAGG - Intronic
1121108074 14:91293620-91293642 CACAGCTACCCCAGGGGGTCTGG - Intronic
1121635659 14:95452339-95452361 CGGAGGAGCCCCGGGTGGACCGG - Exonic
1122081816 14:99272054-99272076 CGCCGCGGGCCCGGGGGGAGCGG + Intergenic
1122226971 14:100285813-100285835 CGCTGCTCCACCGGGGGGAAGGG - Intergenic
1122870035 14:104634305-104634327 GGCAGCTGCCCTGTGGGGACAGG - Intergenic
1122875241 14:104660859-104660881 CTCAGCTCCCCGGGGGGGCCAGG + Intergenic
1123002228 14:105301521-105301543 GGCAGCTGCGCTGGGGGGCCTGG + Exonic
1124208482 15:27743191-27743213 GGCAGCTGCCCTGGGTGGCCGGG - Intergenic
1124442369 15:29696510-29696532 TGCTGCTGCCCCTGGGGGACAGG - Intergenic
1128637513 15:69312638-69312660 GGCAGCTGATCCTGGGGGACGGG - Intronic
1128767349 15:70259276-70259298 CACAGCTGCCCCTGGGAGAGGGG - Intergenic
1129033641 15:72636989-72637011 CTCAGCTGACCTGGCGGGACCGG + Intergenic
1129216245 15:74100244-74100266 CTCAGCTGACCTGGCGGGACCGG - Intergenic
1129408496 15:75336032-75336054 CTCAGCTGACCCTGCGGGACCGG + Exonic
1131336453 15:91553749-91553771 GGCAGGTGCCCTGTGGGGACAGG + Intergenic
1131827977 15:96334918-96334940 CCCAGCAGGCCCGGGGGGCCTGG - Intronic
1132548459 16:544310-544332 CGGGGCTGCCCCGGCCGGACGGG + Intronic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1132804541 16:1769452-1769474 AGCAGCTGCCCCAGGGAGCCGGG - Exonic
1133095693 16:3443620-3443642 CGCAGCTGCCCAGTGGCTACAGG - Exonic
1133130882 16:3675562-3675584 CGCTGCTGCCCCCGTGAGACTGG - Intronic
1133340137 16:5030645-5030667 CCCGGCTGCCCTGGGGAGACTGG - Intronic
1136989335 16:35142551-35142573 GGCATGTGCCCCGGGGGCACAGG - Intergenic
1137661227 16:50208502-50208524 CACAGCTGCCCAGGATGGACTGG - Intronic
1139509081 16:67416245-67416267 CGCGGCTGCCCCGGGGAGGGTGG - Exonic
1139894891 16:70280603-70280625 TGCAGATGCCCCGGGGGAGCAGG + Intronic
1140857872 16:78993676-78993698 TGTGGCTGCCACGGGGGGACAGG + Intronic
1141652554 16:85401405-85401427 TGCTGCTGCCCCAGCGGGACCGG + Intergenic
1141755312 16:85987216-85987238 AGCAGCTGCTCCCAGGGGACAGG - Intergenic
1142155323 16:88530288-88530310 CGCAGCTGCCCCTCAGGGACTGG - Intronic
1142265276 16:89061564-89061586 CTCAGCTGCCCCAGGGGCGCTGG + Intergenic
1142742553 17:1939769-1939791 CCCAGCTGCCCCAGGCGGCCAGG + Intronic
1142903372 17:3026894-3026916 CGCAGCTGCCGAGGGTGGGCTGG + Intronic
1143724034 17:8833147-8833169 CTCCGCTGCCCCTGGGGGCCCGG + Intronic
1145259358 17:21345477-21345499 CACAGCAGCCCCGGGGGCATGGG + Intergenic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1147450213 17:40499705-40499727 CTCAGCTGTCCCGGGAGGGCGGG - Intronic
1148090898 17:45022018-45022040 AGCAGCTGCCGCGGGAGCACGGG - Intergenic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1148904647 17:50904690-50904712 AGAAGCTGCCCCCTGGGGACTGG - Intergenic
1149599714 17:57885534-57885556 CGCTGCTGCTCCGGCGGAACAGG + Exonic
1150382160 17:64729352-64729374 GGCAGCTGCCCCGGTGGCTCGGG - Intergenic
1150774106 17:68065499-68065521 GGCAGCTGCCCCGGTGGCTCGGG + Intergenic
1151492928 17:74443403-74443425 GGCAGCTGGCCCGTGGTGACAGG + Intronic
1151882983 17:76905944-76905966 GGCCGGTGCCCCGGGGGGGCGGG + Intronic
1152120890 17:78417567-78417589 CTCCTCTGCCCCGGGGGGTCAGG - Intronic
1152676734 17:81645159-81645181 CGCAGCTGCTCCCTGGGGAGAGG - Exonic
1152889809 17:82874033-82874055 AGCAGCTGCCACGTGTGGACCGG + Intronic
1152910412 17:83002227-83002249 CTGAGCTGCCCCGTGGGGGCAGG - Intronic
1153565651 18:6414891-6414913 CGCCGCTGCCCCGCGGTGCCCGG + Intronic
1154499493 18:14988180-14988202 TGCATTTGCCTCGGGGGGACTGG - Intergenic
1155415740 18:25597539-25597561 TACAGCTGCCCCAGAGGGACAGG + Intergenic
1155902690 18:31410914-31410936 CGCAGCAGCCACGGCGGGAACGG + Intronic
1159519188 18:69496130-69496152 TGCAGCTGCCCCAGGAGGGCAGG + Intronic
1160254844 18:77239612-77239634 AGCAGCAGCCCCTGGGGGACGGG - Intergenic
1161014843 19:1978464-1978486 CGCAGCTGCACCTGGAGTACCGG + Exonic
1161200054 19:3009568-3009590 AGCTGCTGACCTGGGGGGACAGG + Exonic
1161323634 19:3652595-3652617 CGAAGCTGCCGGGGTGGGACGGG + Intronic
1161854229 19:6754337-6754359 CGCAGCCGCACTGAGGGGACTGG - Exonic
1162296620 19:9818517-9818539 CGCAGCTGGCCGGGCGGGCCTGG - Intronic
1162597447 19:11640094-11640116 CGCAGTTGCCGCGCGGGGACCGG - Intergenic
1162679943 19:12333259-12333281 CGCAGTTGCCGCGCAGGGACCGG + Intronic
1163023511 19:14496138-14496160 CGCAGCGGCGCCTGGGGGGCGGG + Intronic
1163337436 19:16682451-16682473 AGCAGCTGCTCCGAGGGGTCTGG + Exonic
1163632481 19:18424523-18424545 CGCAGAGGCCCTGGGGTGACAGG + Intronic
1164693415 19:30226846-30226868 TGCATCTGCGCTGGGGGGACGGG - Intergenic
1165900723 19:39168051-39168073 AGCAGCTGCCCAGGGTGGTCAGG - Intronic
1167426808 19:49433860-49433882 CGAAGCTGCCTGGGGGGGTCAGG + Exonic
1167455053 19:49593478-49593500 ATCAGCTGCCTCGGGGGGAGGGG - Intronic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
925349231 2:3189536-3189558 CGCAGCAGCTCCGGCGGGGCGGG + Intronic
925741411 2:7008603-7008625 AGCATCTGGCCCGGGGGGACAGG - Intronic
926119921 2:10236278-10236300 CCCAGCTGCCCAGAGGGCACAGG + Intergenic
926124865 2:10265753-10265775 TGCAGCGGCCCCGGGGGGAGTGG - Intergenic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
932366516 2:71156644-71156666 AGCAGCTGCCTCTGGGGGAGGGG - Intergenic
932773587 2:74514628-74514650 CGCGGCTGCTCCGGGTGCACAGG + Exonic
934564446 2:95330544-95330566 GGCAGCTGCCCTGGGGGGTACGG - Intronic
935196681 2:100820380-100820402 CGGAGCGGCCCCGCGGGGCCGGG - Exonic
935686553 2:105688971-105688993 CACAGCTGCCCTGGGTGGAGGGG - Intergenic
938236299 2:129709488-129709510 TGCAGCTGCTCTGGGGGGATGGG - Intergenic
938311151 2:130288787-130288809 CGCAGCTGCTCTCGTGGGACCGG - Intergenic
938496666 2:131801553-131801575 CGCAGCCGCCAGGGAGGGACTGG + Exonic
948445072 2:238026168-238026190 CACAGCTGCCCCGGGCAGCCGGG - Intronic
948568001 2:238898607-238898629 TGCAGCTGCCCCGAGGGGGCTGG + Intronic
948625656 2:239266422-239266444 CCCACCTGCCCAGGGGGGCCTGG + Intronic
948662281 2:239514976-239514998 CGCCGCTGCCCCCGTGTGACAGG + Intergenic
948668425 2:239550995-239551017 CGCAGCCTCCCCAGGTGGACAGG - Intergenic
948756675 2:240163440-240163462 CCCAGCTGCCCTGGGGGTATGGG - Intergenic
949057439 2:241936358-241936380 CGCAGCTGCCTCCCAGGGACAGG + Intergenic
1170596098 20:17806950-17806972 CCCAGCCGCCCCGGGGGGGCAGG + Intergenic
1172126512 20:32627850-32627872 CCCAACTGCCCCGGGTGGCCGGG + Intergenic
1172221165 20:33276073-33276095 CTCAGCTGCCCCCAGGGGCCTGG + Intronic
1172326818 20:34042229-34042251 GGCAGCTGCCTCGGCGGGAGCGG - Intronic
1175180366 20:57142486-57142508 GGCAGCTTCCCAGGGGAGACAGG - Intergenic
1175712913 20:61235309-61235331 CGCTGCTACCCCAGGGGGTCTGG + Intergenic
1175831140 20:61965968-61965990 CGCAGCTGCCCTGCGGGGTAGGG - Intronic
1175944575 20:62552699-62552721 TGCAGGTGCCTGGGGGGGACGGG - Intronic
1176012852 20:62909190-62909212 CACACCTGCCCTGTGGGGACTGG + Intronic
1178431482 21:32522121-32522143 GGCTGCAGCCCCAGGGGGACAGG - Intergenic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1179605593 21:42513692-42513714 CGCACCAGCCCCGGGGCCACCGG - Intronic
1179626987 21:42654258-42654280 CGCACCTGCCCCCGCGCGACAGG - Intronic
1179641356 21:42749453-42749475 AGCAGCTGCCCCAGGAGGTCTGG - Intronic
1179967469 21:44815716-44815738 GGCTGCAGCCCCGGGGGGAATGG + Intronic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180160009 21:45994840-45994862 CTCACCTGCCCCACGGGGACAGG + Intronic
1180201991 21:46229552-46229574 CGTAGCTTCGCCGGGGGGAGTGG + Intergenic
1180455642 22:15511297-15511319 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1181510856 22:23388215-23388237 CGCGGCTGCGGCGGGGGCACTGG - Intergenic
1181517160 22:23421412-23421434 TACAGCTGCCCCCGGTGGACTGG - Intergenic
1182477259 22:30583023-30583045 CACAGCTGGCCCTGGGGGAAGGG - Intronic
1182572321 22:31248561-31248583 CGCAGCTGCTCCGGAGGGAGAGG + Exonic
1183909021 22:41064642-41064664 TGCAGCAGCCCAGGAGGGACAGG - Intergenic
1184691401 22:46119038-46119060 AGCAGCTGGCCTGGGGGGTCTGG + Intergenic
1184784372 22:46664624-46664646 AGCGGCTGCCCCAGCGGGACAGG + Intronic
1185101648 22:48843806-48843828 AGCAGCTGCCCCGAGGGCTCAGG - Intronic
950126649 3:10513899-10513921 CCCAGCTGCCCTGGGGGGTTGGG - Intronic
951258688 3:20481690-20481712 AGCAGCTGCCACTGAGGGACTGG + Intergenic
953193750 3:40713151-40713173 TGAACCTGCCCCGGGGGGAGTGG + Intergenic
954660748 3:52225612-52225634 CGCTGCTGCCCCTGTGGGAAGGG - Exonic
956420230 3:69080015-69080037 CGCAGCGGGCCCGGGGGGCTGGG - Intronic
957405140 3:79766568-79766590 CGCCGCTGCCCCGGGTGGAGCGG + Intronic
960959825 3:123062431-123062453 AGCAGCAGCCCCGCGGGGCCAGG - Intergenic
966390809 3:179451126-179451148 CCCAGCTGCCACGCGGGAACTGG - Intronic
968286129 3:197509970-197509992 CCCAGCTGCCCCAGGAGGAGGGG - Exonic
968456735 4:704199-704221 CACTGCTGCCCCCGGGGGAGGGG - Intergenic
968509390 4:988693-988715 CACAGCTGCCCTGGGGAAACCGG - Exonic
969288413 4:6222467-6222489 GGCCGCTGCTCCGGGCGGACGGG + Intergenic
969339783 4:6532843-6532865 GGCAGCAGCACCGGGGGGCCAGG + Intronic
969563384 4:7963426-7963448 CACAGCTGCCCTGGGGAGAAGGG + Intergenic
975473277 4:74794298-74794320 CGCCGCTGCACCGGGCGGCCCGG + Exonic
978463149 4:108979964-108979986 CGAAGCAGGCCCGGGGGGAAGGG + Intronic
981996444 4:150980525-150980547 CCCAGCTGCCCAGGGGAGAGGGG + Intronic
982082989 4:151808201-151808223 TTCAGCTGCTCCGGGGGCACTGG - Intergenic
984771967 4:183444323-183444345 CGCAGCTGACCCGGCGGGGGAGG + Intergenic
985580291 5:692530-692552 CGCCACTGCCCGGGAGGGACAGG + Intronic
985594947 5:783911-783933 CGCCACTGCCCGGGAGGGACAGG + Intergenic
989011370 5:36876559-36876581 CACAGCCGCCCTGAGGGGACGGG + Intergenic
991630168 5:68648694-68648716 CGCAGCTTCCCATGGGGGAAAGG + Intergenic
1002197638 5:177509870-177509892 CGCAGCTGCCCGGGGCGGGACGG - Intronic
1002799286 6:505657-505679 CAGAGCTGCCCCAGTGGGACCGG - Intronic
1004276084 6:14236236-14236258 AGCAGCTGTCCAGGAGGGACAGG + Intergenic
1007367839 6:41407171-41407193 CGCAGTTGCTCCAGGGGGACAGG + Intergenic
1007949759 6:45860766-45860788 CTCAGCTGCCCCAGGGTAACAGG + Intergenic
1013225560 6:108117762-108117784 CGCCGCTGCCCCGCGCGGCCGGG - Intronic
1017071013 6:150575727-150575749 AGGAGCTGGCCAGGGGGGACTGG + Intergenic
1017498638 6:155003762-155003784 CGCAGCTGCCACGGTGGGGCAGG + Intronic
1017888652 6:158621549-158621571 CGCAGCTGCCTCCGGGAGTCCGG - Intronic
1017899532 6:158707308-158707330 CGCTCCTGCCCCGGAGGGCCAGG - Intronic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1019175801 6:170158913-170158935 CGCTGCGGCCCCGTGGGGGCAGG + Intergenic
1019796632 7:3054665-3054687 CTCAGCTTCCCCAGGGGGAGAGG - Intergenic
1019923156 7:4175436-4175458 TGCACCTGCCCCGGGGTGACCGG + Intronic
1020278208 7:6637248-6637270 CGCCGCTGCCCCCGCGTGACCGG + Intergenic
1021452873 7:20798341-20798363 CTCCGCTGACCCGGAGGGACGGG + Intergenic
1034546548 7:151793494-151793516 CGCAGCTTTCCCGGGGTCACTGG - Intronic
1034902198 7:154914622-154914644 CCCAGGCCCCCCGGGGGGACGGG - Intergenic
1036665374 8:10734024-10734046 TTCAGCTGCCCTGGGGGGAAGGG + Intronic
1037024659 8:14019725-14019747 GGGAGCTGCCCCGGGTGGATTGG - Intergenic
1037599475 8:20381782-20381804 CACAGCTGGCCAGAGGGGACAGG - Intergenic
1037645292 8:20787381-20787403 TGCAGCTGCCCCTGGAGGATGGG - Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1049466049 8:142751745-142751767 CGCAGCAGCCCAGGTGGGTCTGG + Intronic
1049472181 8:142781369-142781391 CGCAGCTGGCCAGAGGGGGCCGG + Intergenic
1049773030 8:144392480-144392502 CACAGCTGCCCCAGGCGCACGGG - Exonic
1049847603 8:144810621-144810643 GGCAGCTGCCCCAGGTGGAAGGG - Intronic
1051418927 9:16871292-16871314 CGCAGCTCCCCGGGGGGGGGGGG - Intergenic
1053104201 9:35396568-35396590 GGCACCTGCCCCTGGAGGACAGG - Exonic
1054718838 9:68583552-68583574 CCCAGCTACCCCGGAGGCACAGG + Intergenic
1054810386 9:69429476-69429498 CCCAGGTGCCCTGGGGGGAAAGG - Exonic
1059854152 9:118376679-118376701 GGCATCTGCCCCGTGGGGTCTGG + Intergenic
1060514604 9:124258048-124258070 CTCGGCTGCCGCTGGGGGACCGG - Exonic
1061211093 9:129193925-129193947 CCCAGCTGCCCCTGGGAGGCAGG - Intergenic
1061326657 9:129868524-129868546 TGCAGTAGCCCCCGGGGGACGGG + Intronic
1061358242 9:130122628-130122650 AGCAGCTGCCCCGGGGGCAGAGG + Intronic
1062060904 9:134494579-134494601 CTCAGCTGCCCCCGGTGGCCAGG + Intergenic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062341382 9:136095204-136095226 CGCAGCTGCCCAGGCCGGACCGG - Exonic
1062379282 9:136279405-136279427 TGCAGTAGCCCCAGGGGGACAGG - Intergenic
1062430796 9:136526090-136526112 CGCTGCAGCCCCGGAGTGACCGG - Intronic
1062554853 9:137109350-137109372 AGCATCTGCCCCGTGGGGCCAGG - Intergenic
1062612072 9:137379892-137379914 CACAGCTGCCACTGGGGGCCTGG - Intronic
1186426134 X:9465317-9465339 CGCGGCTGCTCCGGGGCGCCGGG + Exonic
1186485587 X:9932288-9932310 CAGAGCTGCCCCGGGAGGGCCGG + Exonic
1190354455 X:49591271-49591293 TGCAGCTGCTCAGGAGGGACAGG + Exonic
1199880962 X:151974208-151974230 GGGAGCGGCCCCGGGGTGACCGG - Intronic