ID: 1132629486

View in Genome Browser
Species Human (GRCh38)
Location 16:910309-910331
Sequence CCGCCCCCACACCAGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 10, 3: 65, 4: 626}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132629478_1132629486 9 Left 1132629478 16:910277-910299 CCCCTGGCTGGGCAGGAAGCACG 0: 1
1: 0
2: 1
3: 84
4: 1003
Right 1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG 0: 1
1: 0
2: 10
3: 65
4: 626
1132629480_1132629486 7 Left 1132629480 16:910279-910301 CCTGGCTGGGCAGGAAGCACGCA 0: 1
1: 0
2: 1
3: 17
4: 288
Right 1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG 0: 1
1: 0
2: 10
3: 65
4: 626
1132629479_1132629486 8 Left 1132629479 16:910278-910300 CCCTGGCTGGGCAGGAAGCACGC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG 0: 1
1: 0
2: 10
3: 65
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132629486 Original CRISPR CCGCCCCCACACCAGGGCCC AGG Intronic
900143736 1:1149348-1149370 TCGCACCCTCACCAGGTCCCTGG - Intergenic
900213396 1:1468300-1468322 CCCTCCCCACCTCAGGGCCCTGG + Intronic
900346401 1:2212517-2212539 CCACCCCCACCCCCGGCCCCAGG + Intronic
900457810 1:2785909-2785931 CCACTGCCACGCCAGGGCCCTGG - Exonic
900477878 1:2884426-2884448 CTGCCCCCACACCAAGGGCTGGG - Intergenic
900523731 1:3118527-3118549 CCGCCCCCAGCTCATGGCCCAGG + Intronic
901185321 1:7369089-7369111 CCTCCCCCACCACAGGGGCCTGG + Intronic
901210021 1:7519417-7519439 CCCCCTCCACACCAGGCTCCAGG - Intronic
901556203 1:10033096-10033118 CCGCCTCCACGCCGGAGCCCGGG - Intronic
902616188 1:17624776-17624798 CCACCCACTCACCAGGGCACAGG - Intronic
902617732 1:17632982-17633004 CTCACCCCACACCAGGGCTCCGG - Intronic
903382714 1:22908147-22908169 CCCCACCTACACCAGTGCCCTGG + Exonic
903435186 1:23344092-23344114 CCACCCCCACCCCGGGGCCTCGG + Intronic
903438380 1:23369167-23369189 CCGCCCCCCCCGCAGGGGCCTGG - Intronic
903483378 1:23670841-23670863 CCATCCCCACAGCAGGGCCGAGG - Intergenic
903736730 1:25534569-25534591 CCTCCCCCATGCCTGGGCCCAGG + Intergenic
904003531 1:27351390-27351412 CCGCCCCCAAACCCGGGGACTGG - Intronic
904030409 1:27529873-27529895 TCTCCCCCACACCAGAGACCTGG - Intergenic
904328427 1:29742578-29742600 CCTCCCCCACCCCATGGCCATGG + Intergenic
905028946 1:34868789-34868811 CCGCCCCCACCCCCGGCCCTGGG - Exonic
905294122 1:36943291-36943313 CCTCCCCCATCCCAGGTCCCTGG + Intronic
905626221 1:39491933-39491955 CCGCCGCCGCCCCTGGGCCCGGG - Exonic
905653394 1:39671421-39671443 CTGCCCCCAGCCCAGGGCCCAGG + Intronic
905952446 1:41963504-41963526 CCCACCCCACAACAGGCCCCAGG - Intronic
906572208 1:46852462-46852484 CCCACCCCACAACAGGCCCCAGG - Intergenic
906950728 1:50333053-50333075 CCGCGCCCACACCAGCGCTGCGG - Intergenic
907190276 1:52642224-52642246 CTGCTCCCACCCCAGGGACCTGG - Intronic
907304253 1:53505048-53505070 CAGCCCCCACAGGTGGGCCCTGG + Intergenic
907519734 1:55015370-55015392 CCGCCAAGACACCAGGGCCCTGG + Intergenic
908124115 1:61013360-61013382 CAGCCCCCACCTCAGGGCCCAGG + Intronic
909415631 1:75402723-75402745 CCACCACACCACCAGGGCCCTGG + Intronic
911312778 1:96316395-96316417 CCACCCCCACACCAGGCTTCTGG + Intergenic
913703971 1:121399604-121399626 CCCCACCCCCACCAAGGCCCGGG + Intergenic
913942618 1:125122100-125122122 CCCCACCCCCACCAAGGCCCGGG + Intergenic
913980321 1:143501312-143501334 CCCCACCCTCACCAAGGCCCGGG + Intergenic
914074669 1:144326800-144326822 CCCCACCCTCACCAAGGCCCGGG + Intergenic
914104507 1:144639646-144639668 CCCCACCCTCACCAAGGCCCGGG - Intergenic
914440883 1:147705146-147705168 CCAACCCCACAACAGGCCCCTGG + Intergenic
914755878 1:150561396-150561418 CCGGCCCGGCTCCAGGGCCCTGG + Intergenic
914902172 1:151716678-151716700 CCACCCCCACCCCAGTCCCCGGG + Exonic
915305616 1:154975752-154975774 CCGCCCCCAAACCAAGCCCAGGG - Intronic
915464831 1:156090927-156090949 CAGCGCCCTCACTAGGGCCCAGG + Intronic
916687701 1:167162142-167162164 CCTCCCCCACACCAGATCTCTGG + Intergenic
917965400 1:180175581-180175603 CTGCCCCGACCCTAGGGCCCTGG - Intronic
919744290 1:200999279-200999301 CCGACCCCACACTTGGGCACTGG + Intronic
919806560 1:201384199-201384221 CCACCCCCACCCCAGCCCCCAGG + Intronic
919817018 1:201448137-201448159 CCGCCCCCACCCAGGGACCCTGG + Intergenic
920002115 1:202807567-202807589 CCGCCACCACACAAAGGACCAGG + Intronic
920338551 1:205260685-205260707 CCACCCCCACCCCAGCCCCCTGG + Intronic
921800703 1:219399360-219399382 CCACACCCCCACCAGTGCCCTGG - Intergenic
922339973 1:224647455-224647477 CCACCCCGACACCCAGGCCCAGG - Intronic
922706947 1:227795123-227795145 CCGCAGCCTCGCCAGGGCCCCGG + Intergenic
922766907 1:228160687-228160709 CGGCCCCCACCACAGGGACCTGG - Intergenic
922774884 1:228210102-228210124 CCCCACCCACAGCAGGGCTCTGG - Intronic
923828069 1:237522125-237522147 CCTACCCCACAACAGGCCCCAGG + Intronic
924006981 1:239623267-239623289 CCAACCCCACAACAGGCCCCGGG + Intronic
924011494 1:239670252-239670274 CCACCCCCACCCCAAGCCCCAGG + Intronic
924551689 1:245084060-245084082 CCGCCCCCCCCCCGGCGCCCCGG + Intronic
924553509 1:245099488-245099510 CTGCCCCGACACCAGGCCACAGG + Intronic
924624769 1:245688885-245688907 ACGCCCCCTCCCCAGGGCACGGG - Intronic
924624797 1:245688966-245688988 ACGCCCCCTCCCCAGGGCACGGG - Intronic
1062818849 10:519218-519240 CCCCGGCCACACCAGGGCCCAGG + Intronic
1063338535 10:5240723-5240745 CCCACCCCACAACAGGCCCCCGG - Intergenic
1063664095 10:8051500-8051522 CCGCCGCCGCCGCAGGGCCCGGG - Intergenic
1064245679 10:13666047-13666069 CCACTCCCACGCCCGGGCCCCGG - Intronic
1067091144 10:43266467-43266489 CCACCCCCACGCCAGGCCCCGGG + Intronic
1067228526 10:44390856-44390878 CAGTCCCCACACCAGTTCCCAGG + Intergenic
1067472739 10:46548333-46548355 CAGCCCCTACCCCAGGGCCAGGG + Intergenic
1068345729 10:55775628-55775650 CCCACCCCACAACAGGCCCCAGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1069372472 10:67762742-67762764 CCGGCGCCACACCCTGGCCCTGG + Intergenic
1069743394 10:70699786-70699808 CCTCCCACACACCAGGCACCTGG - Intronic
1070380677 10:75878046-75878068 CCGACCCCACAGCAGGGTCTAGG + Intronic
1071558075 10:86621771-86621793 CCACCCCCACAACAGTCCCCAGG - Intergenic
1072107761 10:92290796-92290818 CCGCCCCGACGCCACGGCCGGGG + Intronic
1073073817 10:100810855-100810877 CCGCCTCCCCCCCATGGCCCTGG + Intronic
1075572260 10:123554835-123554857 GCGCCCTCTCGCCAGGGCCCCGG + Intergenic
1075953729 10:126504726-126504748 AGTCCCCCACACCAGGGCGCGGG + Exonic
1075987859 10:126803553-126803575 CAGCTCCCACCCCATGGCCCAGG - Intergenic
1076165764 10:128281207-128281229 CCACGCTCACACCAGGGCCATGG + Intergenic
1076526548 10:131115907-131115929 CTGCCCCCTCTCCAGGACCCTGG + Intronic
1076664489 10:132078599-132078621 CCGCCCCCAGAGAAGGTCCCTGG - Intergenic
1076724441 10:132406928-132406950 AGGCCCCCACACCATGTCCCAGG - Intronic
1076804939 10:132850580-132850602 TGACCCCCACACCAGAGCCCTGG - Intronic
1076888172 10:133272010-133272032 CCCTCACCCCACCAGGGCCCAGG + Intronic
1076904468 10:133355262-133355284 CAGCTCCCAGACCTGGGCCCTGG - Exonic
1076987181 11:246569-246591 CTGCCCACACACAAGGGACCAGG - Intronic
1077100456 11:820060-820082 CCGCCCCCAGGCCAGCGACCCGG - Intronic
1077112433 11:867765-867787 CCGCCTCGACAGCAGGCCCCAGG - Intergenic
1077130883 11:971918-971940 CCGCTCCCACAGCAGTGCCCTGG + Intronic
1077230823 11:1457502-1457524 CCCCCACCACACATGGGCCCAGG - Intronic
1077231453 11:1459753-1459775 CTGCCCCCATCCCAGGGACCCGG + Intronic
1077268114 11:1662011-1662033 CCTCGCCCACACCTGGCCCCGGG + Intergenic
1077272804 11:1689723-1689745 CCTCACCCACACCTGGCCCCGGG - Intergenic
1077329338 11:1977086-1977108 CCGGGCCCACCCCAGGGCCCAGG - Intronic
1077351463 11:2095074-2095096 CCAGCCCCTCCCCAGGGCCCAGG + Intergenic
1077385064 11:2265445-2265467 CTGCCCCCACAGCAGAGCCCAGG + Intergenic
1077433750 11:2528430-2528452 CAGCCCCCACCCCAGGCACCTGG + Intronic
1079078119 11:17396163-17396185 CCAGACCCACACCAAGGCCCAGG - Intronic
1079831461 11:25274794-25274816 CCCACCCCACAACAGGCCCCAGG + Intergenic
1080588038 11:33699083-33699105 CAGCCACCACACCCGGCCCCTGG + Intronic
1082026799 11:47578627-47578649 CCGCCCCCAGGCCGGGGCACTGG + Intronic
1082167318 11:48964085-48964107 CCGCCTCCACACCGGAGACCTGG + Intergenic
1082609754 11:55282490-55282512 TCGCCTCCACACCAGAGACCTGG - Intergenic
1082841134 11:57690834-57690856 CCTGCCCCACAACAGGCCCCAGG - Intronic
1083342511 11:61967738-61967760 CCTCCCCCACAGCAGGGGCGGGG - Intergenic
1084446926 11:69209202-69209224 CCACCCCCTGACCTGGGCCCAGG + Intergenic
1084455272 11:69264640-69264662 CCGCTCCCTCCCCAGGGCCCAGG - Intergenic
1084787079 11:71448591-71448613 GCGCCCACCCACTAGGGCCCGGG - Intronic
1084872205 11:72105921-72105943 CTCCCTCCACCCCAGGGCCCAGG + Exonic
1085607036 11:77910429-77910451 CCCACCCCACAACAGGCCCCGGG - Intronic
1086577593 11:88358020-88358042 CCTCCCACACTTCAGGGCCCAGG - Intergenic
1087180460 11:95136761-95136783 CCACCCCCACAACAGGCCCCAGG + Intergenic
1088343443 11:108795496-108795518 CCCACCCCACAACAGGCCCCAGG + Intronic
1088462095 11:110093040-110093062 CTGGCCGCACGCCAGGGCCCCGG - Intergenic
1088522039 11:110711533-110711555 TGCCCCCCACACCAGGGTCCTGG - Intronic
1088599110 11:111460039-111460061 CCACCCCCACGCCAGGGCTGTGG + Intergenic
1089396298 11:118138092-118138114 CCTCCTCCACAGCAGCGCCCAGG + Intronic
1089494864 11:118902799-118902821 CCGCCGCCACCCCCGGCCCCTGG - Exonic
1090803483 11:130188745-130188767 TCACCCCCATCCCAGGGCCCTGG - Intronic
1202812317 11_KI270721v1_random:32265-32287 CCGGGCCCACCCCAGGGCCCAGG - Intergenic
1091498298 12:991230-991252 CCGCCGCCACAGCACGGCCCAGG - Intronic
1095237561 12:39816416-39816438 CCCACCCCACAACAGGCCCCGGG - Intronic
1096070151 12:48770844-48770866 CCGCTCCCACATCACTGCCCTGG - Exonic
1096218110 12:49809466-49809488 CCTCCCCCACTCCTGGTCCCTGG - Intronic
1096626339 12:52898429-52898451 CCGCCCTCATCCCAGGGCCCTGG + Intronic
1096626387 12:52898617-52898639 CCGTCCCCACCCCAGGTCCCAGG + Intronic
1096649292 12:53054058-53054080 CCGGCCCCACACCTCAGCCCAGG + Intronic
1097676126 12:62603667-62603689 CCTCCCCGACACCATGGCCCTGG + Exonic
1098069534 12:66657307-66657329 TCGCCGCCACACCACTGCCCAGG + Intronic
1098819472 12:75209364-75209386 TCTCCCCCACCCCAGCGCCCAGG - Exonic
1099128666 12:78798975-78798997 CCCACCCCACAACAGGCCCCCGG + Intergenic
1099418584 12:82424372-82424394 CCCACCCCACAACAGGCCCCGGG - Intronic
1099960459 12:89392152-89392174 CCTCCCCCACTCCAGGGTCAGGG + Intergenic
1101054046 12:100894274-100894296 CCTCCACCACACCAGGTCCTTGG - Intronic
1101850470 12:108397917-108397939 CCCACCCCACAACAGGACCCCGG - Intergenic
1102031764 12:109743874-109743896 CAGCCCCCACTCAAGAGCCCTGG + Intronic
1102456004 12:113071251-113071273 CCGCCCCCACACCCGGTCTCAGG + Intronic
1102510398 12:113411403-113411425 CCCTCCCCACTCCAGGACCCTGG + Intronic
1102584715 12:113914926-113914948 CCGCCCACACGCCAGTCCCCTGG + Intronic
1102646161 12:114405345-114405367 CCGCGCCCTCGCCAGGGTCCCGG + Intronic
1102699104 12:114823765-114823787 CCTGCCCTACTCCAGGGCCCAGG + Intergenic
1103128852 12:118449030-118449052 CCACCCCCACAACAGGCCCCAGG + Intergenic
1103649480 12:122422157-122422179 CCGCTCCCTCTCCTGGGCCCCGG - Intronic
1103738887 12:123078277-123078299 CCTCCCCCATACCAGGCCTCAGG + Intronic
1104759717 12:131289648-131289670 CCGGCCCCACCCCTGAGCCCGGG + Intergenic
1104910120 12:132236285-132236307 CGACCCCCACTCCAGGGCCATGG - Intronic
1104977939 12:132560459-132560481 CCGCCTCCACCCCCGGACCCCGG - Intronic
1105964416 13:25371961-25371983 CCGCCCCCACGCCGCAGCCCGGG + Intergenic
1106340240 13:28820238-28820260 CCGCCCCCGCTCGAGGGCCGGGG - Intergenic
1106753920 13:32802286-32802308 CCACCCCCACATCAAGGCCTAGG + Intergenic
1106959614 13:34983176-34983198 CCCACCCCACACCAGGCCCCAGG + Intronic
1111269537 13:85863386-85863408 CCCACCCCACAACAGGCCCCGGG + Intergenic
1111299125 13:86323334-86323356 CCGACCCCACAACAGGCCCCGGG - Intergenic
1112750115 13:102574432-102574454 CCACCCCCACCCCCAGGCCCTGG + Intergenic
1113178504 13:107596658-107596680 CACCCCCCTCAACAGGGCCCCGG - Intronic
1113682930 13:112256912-112256934 CCGCACCCACACCAGGCCCTGGG + Intergenic
1113841756 13:113364715-113364737 GCCCCCCCAAACCAGGGACCGGG + Intergenic
1114473778 14:22980864-22980886 CCGCGCCCCCACCCGGGCCCAGG - Intronic
1116828356 14:49693437-49693459 CCGCCCCCACAGCCGCGCCAGGG + Intronic
1117894781 14:60472556-60472578 CCCTCCCCACAACAGGCCCCGGG + Intronic
1118220958 14:63853733-63853755 CCGCCGCCCCTCCAGTGCCCGGG - Intronic
1118339093 14:64879819-64879841 CCGCCGCCACCCCCGGGCTCGGG - Exonic
1118770195 14:68937832-68937854 CCGCCCACACAGCAGGGGGCTGG - Intronic
1119266267 14:73264753-73264775 CCTCCCCCACGCCAGGGCCAGGG + Intronic
1119407411 14:74407329-74407351 CCAGCCCCAGAGCAGGGCCCGGG - Exonic
1119855510 14:77897406-77897428 CTGCCCCACCACCAGGGCCCTGG - Intronic
1120349192 14:83330784-83330806 CCCACCCCACAACAGGCCCCAGG + Intergenic
1121019499 14:90570504-90570526 CCACCTCAAAACCAGGGCCCTGG + Intronic
1121787155 14:96670664-96670686 CCCCCCTCACACCCAGGCCCTGG + Intergenic
1122158452 14:99765380-99765402 CCCCCACCACGCCAGGCCCCTGG + Intronic
1122264763 14:100541440-100541462 CTGTCCCCCCACCACGGCCCTGG + Intronic
1122799912 14:104224380-104224402 CTGCCCCCTCCCCAGGGCCCTGG - Intergenic
1122938345 14:104970201-104970223 CCGCCGGCACCCCAGGGACCAGG + Intronic
1122971364 14:105153560-105153582 CCGCCGCCTCTCCAGGGCCCTGG - Intronic
1123014450 14:105367141-105367163 CAGCCCACACATCAGGGCACCGG + Intronic
1202939507 14_KI270725v1_random:134068-134090 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1123393634 15:19901847-19901869 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1123697870 15:22892028-22892050 CTGCCCCCACCGCAGAGCCCGGG + Intronic
1123941235 15:25217601-25217623 CCGCCCCCCAACCAGGCCCCAGG - Intergenic
1123946357 15:25240698-25240720 GCCACCCCACACCAGGCCCCAGG - Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124371821 15:29108417-29108439 CCACCACCACTGCAGGGCCCAGG + Intronic
1124437574 15:29663699-29663721 CCTCCCCCACAACAGGCCGCGGG - Intergenic
1124708121 15:31982488-31982510 GTGCCCCCACACCAGTGCCCAGG + Intergenic
1125522503 15:40356154-40356176 CCACCCCCCCACCATGGTCCAGG + Exonic
1125522535 15:40356220-40356242 CCACCCCCCCACCATGGTCCAGG + Exonic
1125546727 15:40511675-40511697 ACGCTCCCTCCCCAGGGCCCGGG + Intergenic
1126513306 15:49504262-49504284 CCCACCCCACAACAGGCCCCGGG - Intronic
1126837275 15:52679498-52679520 CCGGCCCCAAACTAGCGCCCCGG - Intronic
1128073618 15:64812556-64812578 CCCACCCCATCCCAGGGCCCAGG + Intergenic
1128368763 15:67023999-67024021 CCGCCCCCACAGGAGGAGCCAGG - Intergenic
1128374767 15:67066660-67066682 CCGCCCCCACTCCGGGGAGCTGG + Intronic
1128744695 15:70105292-70105314 CCCACCCCACAACAGGCCCCAGG - Intergenic
1128758835 15:70201097-70201119 CCGCCCCCTCGCCCAGGCCCAGG - Intergenic
1129032686 15:72629985-72630007 CCGGCCCAACACCAGATCCCAGG - Intergenic
1129191989 15:73942679-73942701 CTGACCCCACACCTGGGCCCAGG + Intronic
1129236324 15:74225832-74225854 CCTACCCCTCACCAGGGCCAGGG - Intergenic
1129251097 15:74309337-74309359 CCACCTCCACACCAGGTGCCTGG + Intronic
1129599784 15:76992019-76992041 CCCCACCCACACCCAGGCCCAGG - Intergenic
1129660236 15:77549249-77549271 CCGCCCCCATGCCAGGGTACAGG + Intergenic
1129711032 15:77820267-77820289 CCGGCCCCACCCGGGGGCCCCGG + Intronic
1130584332 15:85168776-85168798 CCGCCCCCACCCCCGCCCCCAGG - Intergenic
1130956245 15:88629357-88629379 CGGCCTCCACACCCGGGCCCGGG + Exonic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131659845 15:94502118-94502140 CCCACCCCACAACAGGCCCCGGG - Intergenic
1132230588 15:100181091-100181113 CCGCCACCACACAAGGCCCATGG + Intronic
1132629486 16:910309-910331 CCGCCCCCACACCAGGGCCCAGG + Intronic
1132658617 16:1051750-1051772 CCGCCCCCACGCCCAGACCCCGG - Intergenic
1132670820 16:1101714-1101736 CGGCCCACACACCGGGGCACGGG - Intergenic
1132745688 16:1435306-1435328 TCGTCCCCACTGCAGGGCCCAGG + Intronic
1132765077 16:1530477-1530499 CCAGCCCCACACCTGGGCCTCGG - Intronic
1132774243 16:1583112-1583134 ACGCCCACACAGCAGGCCCCAGG + Intronic
1132830989 16:1928215-1928237 CTTCCCCCACAGCAGGGGCCTGG - Intergenic
1132975610 16:2709786-2709808 TCCACCCCTCACCAGGGCCCTGG - Intergenic
1132977131 16:2716469-2716491 TCCCTCCCACCCCAGGGCCCTGG + Intronic
1132998461 16:2836626-2836648 CCGCACCCACCCCCCGGCCCAGG + Intronic
1133036347 16:3036234-3036256 TGGGCCCCACGCCAGGGCCCTGG - Intronic
1133201804 16:4208386-4208408 CCGCCCCCGCACCGCGACCCTGG + Intronic
1133212498 16:4271448-4271470 CCTCCCCCACACCACGCCCAGGG + Intronic
1134068539 16:11246130-11246152 CTGCCCCCACACCCCTGCCCAGG + Intergenic
1134223813 16:12376223-12376245 CAGCCCCCACGCCACGTCCCTGG + Intronic
1134441270 16:14301164-14301186 CCACCCCCACACCCCTGCCCAGG - Intergenic
1135040917 16:19115826-19115848 CAGCCGCCCCACCAGGGCCCAGG - Exonic
1135415774 16:22267010-22267032 CTGCCCCCAAACCAGTGCCTGGG - Intronic
1136695923 16:32081971-32081993 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1136699638 16:32119216-32119238 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1136768020 16:32808705-32808727 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1136796418 16:33025224-33025246 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1136858639 16:33681135-33681157 CCCCCCCCACCCCCGGCCCCGGG - Intergenic
1136868283 16:33773540-33773562 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1136958029 16:34806403-34806425 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1137057158 16:35751263-35751285 CTGGGCCCCCACCAGGGCCCGGG + Intergenic
1138458568 16:57134718-57134740 CCGCCCCCAAACCCAGACCCAGG - Intronic
1138552233 16:57754195-57754217 TCCCCCACACACCAGGGCACAGG - Intronic
1138567557 16:57844656-57844678 CCGCCCCCTCCGCAGGCCCCAGG + Intronic
1139545297 16:67647101-67647123 CCACCCTCCCACCAGGGACCTGG + Exonic
1139950438 16:70665675-70665697 CCCCCCCTACCCCAGGGCCACGG + Intronic
1140469886 16:75208015-75208037 GCGCCAGCACACCTGGGCCCTGG + Intergenic
1141669547 16:85484716-85484738 CCGACTCAAAACCAGGGCCCTGG + Intergenic
1141677203 16:85524095-85524117 CGGCCCCCAGACCTGGGCCCCGG - Intergenic
1141694020 16:85611632-85611654 GCGCCCCCACCTCCGGGCCCCGG + Intronic
1142051261 16:87959750-87959772 CCACCCCCTCACCCGGGACCTGG - Intronic
1142114049 16:88347276-88347298 CCACCCCCACACCCGTGCACGGG + Intergenic
1142206150 16:88784227-88784249 CCTCCCCCAGACCAGGGCAGAGG + Intronic
1142291953 16:89197258-89197280 CCGGCCACACAGCAGGGTCCAGG - Intronic
1203070410 16_KI270728v1_random:1070725-1070747 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1203073700 16_KI270728v1_random:1105794-1105816 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1203103891 16_KI270728v1_random:1342736-1342758 CCCCACCCCCACCAAGGCCCGGG - Intergenic
1203129623 16_KI270728v1_random:1619632-1619654 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1142836994 17:2594261-2594283 CAGCCCCCAAAGCCGGGCCCGGG - Intronic
1143277495 17:5722562-5722584 CCACCCCCACACCACTGCCTTGG + Intergenic
1143405247 17:6673113-6673135 CCTCCCCCACTCCAGTCCCCAGG - Intergenic
1143768436 17:9152503-9152525 CCGCCACCACCCCAGGGCCATGG + Intronic
1144586905 17:16492418-16492440 TCGCCCCCGCGCCACGGCCCCGG - Intergenic
1144792298 17:17867209-17867231 CCACCCTCCCTCCAGGGCCCAGG - Intronic
1146259211 17:31410789-31410811 CAGCTCCAAGACCAGGGCCCTGG + Intronic
1146271602 17:31488740-31488762 CCGGCCCCACACCACGACCTGGG - Intronic
1147582419 17:41634861-41634883 CCACCCTTACCCCAGGGCCCTGG - Intergenic
1148115591 17:45172848-45172870 CTTCCCCCACCCCAGGCCCCAGG + Intergenic
1148178031 17:45584708-45584730 CCACCCCAGCACCAGCGCCCCGG - Intergenic
1148341313 17:46875144-46875166 CCTCACCCACACCCTGGCCCGGG + Exonic
1148441741 17:47715062-47715084 TCAGCCCCACAGCAGGGCCCTGG + Intergenic
1148736805 17:49869627-49869649 CGCCCCCCACCCCCGGGCCCAGG + Intergenic
1148804800 17:50258803-50258825 TCCCCTCCACCCCAGGGCCCGGG + Intergenic
1148930021 17:51120588-51120610 CCGCTCCGACATCACGGCCCCGG + Exonic
1149512070 17:57250922-57250944 CCCCCACCCCCCCAGGGCCCTGG + Intergenic
1150128449 17:62653371-62653393 CCGCCCCCACCCCCGGGGCGGGG + Intronic
1150226548 17:63527657-63527679 CTGTGCCCTCACCAGGGCCCTGG - Intronic
1150249678 17:63698998-63699020 CCTCCCGCACACCCGGCCCCAGG + Intronic
1150273663 17:63882459-63882481 CCGCCCCCGCCCCAAGGCTCAGG - Intergenic
1150407919 17:64918994-64919016 CCACCCCAGCACCAGCGCCCCGG - Intronic
1150747305 17:67825973-67825995 CCCCCCCAGCACCAGCGCCCCGG + Exonic
1151212059 17:72551889-72551911 CCCACCCCACAGCAGGCCCCAGG + Intergenic
1151749151 17:76027053-76027075 CCACCCCCACCCCAGTTCCCCGG + Intronic
1151807023 17:76412102-76412124 CCAGCCCCACACTAGGTCCCTGG + Intronic
1152408993 17:80112563-80112585 CCCCCACCACCCCAGGGCGCTGG + Intergenic
1152597377 17:81244406-81244428 CCTCCCCCAGACCCAGGCCCTGG + Intergenic
1152625351 17:81385623-81385645 CCACTCCCACCCCAGGGCGCAGG + Intergenic
1152781986 17:82230751-82230773 CCGCCCCTGCCCCAGGGCCCGGG - Intronic
1152883706 17:82835300-82835322 CCTCCCACACGCCAGGGGCCAGG + Intronic
1153131880 18:1863303-1863325 CCCCCCACATCCCAGGGCCCTGG + Intergenic
1154070627 18:11149008-11149030 CCGCCCCCAAACGACGCCCCGGG - Intergenic
1154079489 18:11242284-11242306 CCTTCCCCACCCCAAGGCCCTGG - Intergenic
1155535768 18:26815833-26815855 CCAACCCCACAACAGGCCCCGGG + Intergenic
1155539116 18:26848713-26848735 CCCACCCCACAACAGGCCCCAGG - Intergenic
1156456812 18:37299427-37299449 CGGCCCCCATACCAGGCCCCTGG - Intronic
1156458127 18:37306128-37306150 CTGGCCCCCCACCAGGACCCAGG - Intronic
1159104563 18:63990672-63990694 CCCACCCCACAACAGGCCCCGGG + Intronic
1159839275 18:73377800-73377822 CCCACCCCACAACAGGCCCCAGG - Intergenic
1160392808 18:78547903-78547925 GGACCCCCACACCAGGGGCCCGG - Intergenic
1160438150 18:78867095-78867117 CGGCCCCCACACCTGCCCCCAGG + Intergenic
1160682177 19:416936-416958 CCGCCTCCTCCCCAGGGTCCTGG + Exonic
1160818020 19:1045143-1045165 CCAACCCCAGACCTGGGCCCCGG + Exonic
1160876831 19:1300357-1300379 CCTCCCCCAGGCCAGGGCACAGG - Intergenic
1160948761 19:1655697-1655719 CTGTCCCCGTACCAGGGCCCTGG - Intergenic
1160977837 19:1802453-1802475 CAGCTCCCACTCCAGGACCCTGG + Intronic
1161040572 19:2108924-2108946 CAGCCCCCGCACCAGCTCCCAGG + Intronic
1161210524 19:3062964-3062986 CCCGCCCCACCCCAGGGCCCTGG - Exonic
1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG + Intronic
1161575145 19:5050935-5050957 CCACCCCCACCCCAGGTTCCAGG - Intronic
1161818522 19:6515331-6515353 CCCACCCCACACCAGGGGCGTGG + Intergenic
1161850259 19:6734300-6734322 CCACCCTCACCCCAGGGTCCAGG - Exonic
1161939724 19:7394981-7395003 ACGCCCCCTCACCACGGCTCGGG + Intronic
1162018921 19:7859974-7859996 CGGCTCCCACCCCAGGGACCAGG + Intronic
1162130121 19:8521335-8521357 CAGCCCCCGCCCCTGGGCCCTGG - Exonic
1162443416 19:10707451-10707473 CTACCCCCTCACCAGGCCCCTGG + Intronic
1162551608 19:11361311-11361333 CCGCCCCAACTACACGGCCCTGG + Exonic
1163020791 19:14479924-14479946 CCACCCCCACCTCAGGGGCCTGG + Intronic
1163282059 19:16324458-16324480 CCGCCCCCGCTCCAGGTCCCCGG + Intergenic
1163370328 19:16897679-16897701 CCGCGCACTCACCCGGGCCCCGG + Exonic
1163438588 19:17310035-17310057 CCTCCCCCGCCCCGGGGCCCAGG - Intronic
1163455808 19:17405083-17405105 CTGCCCCTACACCAGTGCCCTGG + Intronic
1163632349 19:18423956-18423978 GCGCCCCCAGACCTGGCCCCCGG + Intronic
1163822856 19:19506068-19506090 CCGCCCACCCTCCAGGGCACAGG - Exonic
1165001379 19:32765725-32765747 CCCACCCCACAACAGGCCCCCGG - Intronic
1165227469 19:34365118-34365140 CCGGCCCCACCCCTGAGCCCCGG - Intronic
1165258557 19:34594741-34594763 CCACCCCAACAGCATGGCCCAGG - Exonic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1165385975 19:35510883-35510905 CAGCTGCCACCCCAGGGCCCCGG - Intronic
1165757793 19:38304391-38304413 CCGCCCCCACACCGGGCTTCTGG - Exonic
1165785991 19:38462392-38462414 CTGTCCCCAGACCAGTGCCCTGG + Intronic
1166054255 19:40279242-40279264 CGGCACCCACAGCAGGGCCCAGG - Intronic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166281946 19:41799972-41799994 CCGCCCACAAACCAGGACCAGGG - Intronic
1166354246 19:42217558-42217580 CCGCCCGCTCCCCAGAGCCCAGG + Intronic
1166358679 19:42242531-42242553 CCGCCGCCTCCCCCGGGCCCTGG + Exonic
1166441089 19:42815998-42816020 CCACCCCCACACCAGTGCCCAGG - Intronic
1166460563 19:42984605-42984627 CCACCCCCACACCAGTGCCCAGG - Intronic
1166477863 19:43144578-43144600 CCACCCCCACACCAGTGCCCAGG - Intronic
1166536631 19:43578721-43578743 CCACCTCCCCACCAGGTCCCAGG - Intronic
1166700536 19:44879281-44879303 CCACCTCCACCCGAGGGCCCAGG - Intronic
1166737231 19:45093295-45093317 CCGCCTCCTCACGGGGGCCCCGG - Exonic
1166809353 19:45506638-45506660 CCGCCCCCACACGCCGGCTCCGG - Intronic
1166876543 19:45901395-45901417 GCGCCGCCACACCTGGCCCCAGG + Exonic
1166876671 19:45901916-45901938 CCGCCCCCACTCCTGCCCCCGGG - Intronic
1166994001 19:46710692-46710714 CCGCCCCTAGACCTGAGCCCCGG + Intronic
1166996598 19:46722514-46722536 CCCGCCCCAAAACAGGGCCCAGG - Intronic
1167251057 19:48398596-48398618 CCGCCGCCACGGCCGGGCCCAGG - Exonic
1167425776 19:49429006-49429028 CCCCTCCCACCCCAGGGCTCAGG - Intergenic
1167429002 19:49443580-49443602 CCGCCTCCGCACCCGGGCCGGGG - Intergenic
1167499279 19:49836298-49836320 CCTCCGCCGCACCAGGGCCTGGG + Exonic
1167632316 19:50632641-50632663 CCAGCCCGACACCAGGGCCTAGG + Exonic
1167691112 19:50983969-50983991 CCGCCTGCACCCCAGGGCGCTGG - Intronic
1167740290 19:51320486-51320508 CAGCCCCCACTCCCTGGCCCTGG + Intronic
1167959572 19:53095164-53095186 CCGCCCCCTCCCCACTGCCCAGG + Intronic
1168515214 19:57005104-57005126 CTCCCCCCACAACAGGCCCCAGG + Intergenic
1168519545 19:57037498-57037520 CCACCTCCACACCAGGCCCTGGG + Intergenic
1168706941 19:58475774-58475796 CCGCCCCCACGCCATTCCCCGGG - Intronic
925008809 2:467180-467202 CCTCCCTCCCACCTGGGCCCTGG + Intergenic
925277526 2:2661055-2661077 TCACCCCCACAGCAGAGCCCGGG + Intergenic
925356068 2:3242225-3242247 CCGACTCCACACCATGGGCCCGG + Intronic
925859858 2:8163717-8163739 GCGCCACCACACCAGGCCCATGG + Intergenic
927140916 2:20130216-20130238 CCTCTCCCACCCCAGGCCCCAGG + Intergenic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
929073662 2:38059474-38059496 CCGTCCCCACTCCAGTTCCCAGG - Intronic
929438908 2:41950001-41950023 CCCCTCCCCCACCACGGCCCTGG - Intronic
929456960 2:42072951-42072973 CCTCCCCCACCCCTGAGCCCAGG + Intergenic
930035065 2:47080168-47080190 CAGCCCCCACGCAAGGGCCAGGG + Intronic
930437595 2:51364756-51364778 CCCACCCCACAACAGGCCCCAGG - Intergenic
930545358 2:52760659-52760681 CCTACCCCACAACAGGCCCCGGG - Intergenic
932485849 2:72083928-72083950 CCCTCCCCACCCCAGGGCTCCGG - Intergenic
932506983 2:72243579-72243601 CCCACCCCACAGCAGGCCCCAGG - Intronic
932761259 2:74440497-74440519 CCGCCTCCACGCCAGGCCCACGG + Intronic
932773731 2:74515110-74515132 CCGCCCAAACCCGAGGGCCCAGG - Exonic
934477708 2:94604151-94604173 ACACCCCCAACCCAGGGCCCTGG - Intronic
934929896 2:98413636-98413658 CAGCCACCACCCCAGGACCCAGG - Intergenic
934998269 2:98987254-98987276 CCCACCCCACAACAGGCCCCAGG + Intergenic
936071646 2:109375326-109375348 CCGTCCCCACGCCAGGACCCAGG + Intronic
937046914 2:118856720-118856742 CCACCCCCACCCCAGGGCTCAGG - Intergenic
937721533 2:125102346-125102368 CCACCCCCGCAACAGGCCCCGGG - Intergenic
938121731 2:128638858-128638880 CTCAGCCCACACCAGGGCCCTGG - Intergenic
938517846 2:132035468-132035490 CCCCACCCCCACCAAGGCCCGGG - Intergenic
938590228 2:132728804-132728826 CCGACCCCTCACCTGGGTCCCGG + Exonic
942505457 2:176637671-176637693 CCGCCCACGCACGAGGCCCCCGG - Intergenic
942952583 2:181737650-181737672 CCCACCCCACAACAGGCCCCGGG - Intergenic
944249042 2:197562662-197562684 CCCACCCCACAACAGGCCCCGGG + Intergenic
944295526 2:198057341-198057363 CTACCCCCACACCAGGGAACAGG - Intronic
946399384 2:219460685-219460707 CCCCCTCCACACCAGGGCCCAGG + Intronic
946409629 2:219509590-219509612 CTCCCTCCACACCAGAGCCCAGG - Intergenic
947349241 2:229225486-229225508 CCACCCCTACTCCAGGGCCAGGG + Intronic
948200941 2:236129299-236129321 CCGTCCCCACAGCAGGGCTGGGG - Exonic
948205198 2:236159773-236159795 CCGCCCCCCCACCCCGGGCCCGG + Intergenic
948352180 2:237350146-237350168 CCGTCTCCCCACGAGGGCCCCGG + Exonic
948528785 2:238589816-238589838 CAGACCCCAAAACAGGGCCCAGG - Intergenic
948624533 2:239260949-239260971 CCGTCTCCACCCCAGTGCCCTGG - Intronic
948695089 2:239729323-239729345 CCCCACCCACAGCAGGCCCCAGG - Intergenic
948835168 2:240622875-240622897 CCGTGCCCACAGCAGGACCCTGG + Intronic
948860628 2:240751057-240751079 GCACCCCCAGCCCAGGGCCCAGG + Intronic
948919110 2:241053059-241053081 CCGACCCGACTGCAGGGCCCAGG - Intronic
949033737 2:241807379-241807401 CCCCCCTCACGCCAGGGACCCGG + Intergenic
949043806 2:241861075-241861097 CCCACCCCACACCTGAGCCCTGG - Intergenic
1168752031 20:289523-289545 CAACCCCCACACCAGCTCCCAGG + Intronic
1169064188 20:2684788-2684810 CCCACCCCACAACAGGCCCCGGG - Intergenic
1170957117 20:20991555-20991577 CCGCTCCCACACCAGGGCTGAGG + Intergenic
1171011328 20:21510870-21510892 CCCCGCCCGCCCCAGGGCCCCGG + Intergenic
1171102699 20:22400424-22400446 CCACCCCCACCCCAAGCCCCTGG + Intergenic
1171330855 20:24337742-24337764 CCGCCGCCCCTCCATGGCCCTGG + Intergenic
1171464449 20:25317844-25317866 CCGACCCCACAGCAGGGACATGG + Intronic
1171564146 20:26163015-26163037 CCGACCCCACAGCAGTGTCCAGG + Intergenic
1172625326 20:36343392-36343414 GATGCCCCACACCAGGGCCCAGG + Intronic
1172852486 20:37976735-37976757 CCTCCCCCACACCTACGCCCAGG + Intergenic
1172889112 20:38251488-38251510 CCACCCCCACTCCATTGCCCAGG - Intronic
1173657628 20:44711363-44711385 CAGCCCCCACACAAGGGCCCAGG - Intergenic
1173868437 20:46327644-46327666 TCTCCTCCACCCCAGGGCCCAGG - Intergenic
1174386213 20:50190038-50190060 CCTGCCCCATCCCAGGGCCCAGG + Intergenic
1174967082 20:55228479-55228501 CCCACCCCACAACAGGCCCCAGG + Intergenic
1175717258 20:61263417-61263439 CAACCCCCACATCAGGGGCCAGG + Intronic
1175769961 20:61617304-61617326 ACTGCCCCACACCAGGCCCCAGG - Intronic
1175877779 20:62238612-62238634 CCGCCGCCACGCGAAGGCCCGGG + Intronic
1175917605 20:62434043-62434065 CCTCCCCGACACCAGGCTCCTGG - Intergenic
1175946923 20:62563297-62563319 CCGTCCTCACTCCAGGGCCAGGG + Intronic
1176007925 20:62876249-62876271 CCGACCTCACTCCAGGGCTCAGG - Intergenic
1176127517 20:63482555-63482577 GCGGCCCCAAATCAGGGCCCTGG - Intergenic
1176129030 20:63488471-63488493 CCCCCCCAACCCCAGGGCTCTGG + Intronic
1176130418 20:63494482-63494504 CCGCCCCCATGGCAGGGCTCTGG + Intronic
1176228740 20:64019520-64019542 CCTCCCGGACACCAGGGCCCTGG + Intronic
1176583685 21:8553021-8553043 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1178536530 21:33414595-33414617 CCGGCCAGACTCCAGGGCCCAGG + Intronic
1179961032 21:44767086-44767108 CCCCCCCCAGCCCAGGGTCCAGG + Intergenic
1179963047 21:44781674-44781696 TCACCCCCAGAGCAGGGCCCTGG + Intronic
1179981269 21:44897140-44897162 CTGCTCCCACTCCAGAGCCCGGG + Intronic
1180047646 21:45317201-45317223 CCCCCCCCACACCAGGGTCCGGG - Intergenic
1180060687 21:45383453-45383475 CCGACCCCACCGCAGGGGCCAGG - Intergenic
1180172956 21:46070018-46070040 CCGCCCCCTCAGCTCGGCCCTGG - Intergenic
1180247018 21:46555071-46555093 CCTACTCCCCACCAGGGCCCGGG - Intronic
1180266495 22:10529954-10529976 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1181084216 22:20431893-20431915 CCTCCCCCGCCCCAGGTCCCCGG + Intronic
1181165157 22:20979375-20979397 CCGCCCCCATCCGAGGCCCCGGG - Intronic
1181275961 22:21687801-21687823 CCTGCCCCATCCCAGGGCCCTGG + Intronic
1181523152 22:23460711-23460733 ACGCCCACACACCAGGCTCCGGG - Intergenic
1181634270 22:24167102-24167124 CCGCCACCACCACAGGGACCAGG + Exonic
1181670637 22:24424124-24424146 CCGCCCCGAGACCAGTTCCCCGG + Intronic
1183188409 22:36305880-36305902 CTGCACGCACAGCAGGGCCCAGG + Intronic
1183744819 22:39686222-39686244 CCGCCCCCACGCCGCCGCCCTGG + Exonic
1183831137 22:40418889-40418911 CCGCCCGCCCCCCAGGGCTCAGG + Exonic
1183931453 22:41238173-41238195 CTGCCCCCGCTGCAGGGCCCGGG - Exonic
1184187038 22:42871837-42871859 CTGTCCCCTCCCCAGGGCCCCGG + Intronic
1184241354 22:43212708-43212730 CCGTCCCCACCCCAGGCCTCGGG - Intronic
1184451260 22:44584117-44584139 CCGCCCCCTCACCTGGCTCCAGG + Intergenic
1184458288 22:44623785-44623807 CAGCCACGCCACCAGGGCCCAGG + Intergenic
1184501868 22:44879369-44879391 CAGCCCCCTCGCCAGGACCCTGG - Intergenic
1184583761 22:45434179-45434201 CCCACCCCACACCAGACCCCAGG - Intergenic
1184648264 22:45907872-45907894 CCTGCCCCACCCCAGGGCCAGGG - Intergenic
1184725133 22:46340136-46340158 CCGCCCCCAGACCTCGGTCCAGG - Intronic
1184731508 22:46373473-46373495 CCCCCCCCACCCCAGAGCACTGG - Intronic
1184959601 22:47919434-47919456 CAGCCCCCACCCCAGGGAACTGG - Intergenic
1185037930 22:48489457-48489479 CCGCCGCCGCGCCCGGGCCCCGG - Exonic
1185044766 22:48523375-48523397 CCGGCCACACAGGAGGGCCCAGG - Intronic
1185106074 22:48870669-48870691 CGGCCCCCACAGGGGGGCCCAGG - Intergenic
1185230459 22:49677542-49677564 CCGCCCCCTGAGCAGGACCCTGG + Intergenic
1185292233 22:50032878-50032900 CCTCCCCTGCGCCAGGGCCCAGG + Intronic
1185324653 22:50219746-50219768 CCGCCTCCTCACCACGGCCTGGG + Exonic
1185415189 22:50705696-50705718 CAGCCCCCACCCCATGGCTCTGG + Intergenic
950045742 3:9947670-9947692 CAGCCGCCCCAGCAGGGCCCCGG - Exonic
950612462 3:14135040-14135062 CCACCTCCACACCCGTGCCCAGG - Intronic
950630761 3:14280215-14280237 CCGACCCCACACCTGTGGCCTGG + Intergenic
952320050 3:32268430-32268452 CCTACCCCACAACAGGCCCCGGG - Intronic
952320278 3:32270706-32270728 CCCACCCCACAACAGGCCCCGGG - Intronic
953493764 3:43369672-43369694 CCCCCTCCATACCATGGCCCTGG - Intronic
954305699 3:49724206-49724228 CCGGCCCCGCCCCACGGCCCCGG + Intergenic
954376106 3:50195012-50195034 CCCACCCCACACCACGGCCCTGG + Intronic
955220167 3:57016793-57016815 CCTCCCCCACACCAGGGAAAAGG - Intronic
956113723 3:65897454-65897476 CCCACCCCACAGCAGGCCCCAGG - Intronic
956386936 3:68729492-68729514 CCCACCCCACAACAGGCCCCGGG + Intergenic
956579190 3:70791543-70791565 CCCACCCCACAACAGGCCCCGGG + Intergenic
958623968 3:96601491-96601513 CCCACCCCACAACAGGCCCCAGG + Intergenic
958641532 3:96813496-96813518 CGGCCCCCGCCCCAGGGCCGGGG - Intergenic
960684733 3:120285178-120285200 CCGCCTCCACGCCAGGCTCCCGG - Intergenic
960751585 3:120960746-120960768 CCCACCCCACAACAGGCCCCAGG - Intronic
960779573 3:121303864-121303886 CCCACCCCACAACAGGCCCCGGG - Intronic
960783436 3:121346109-121346131 CCGACCCCACAACAGGCCCCAGG + Intronic
961104004 3:124225602-124225624 CCTTCTCCCCACCAGGGCCCAGG - Intronic
961403327 3:126662451-126662473 CCGCCTCCACAGCATGGCACCGG + Intergenic
961452376 3:127008209-127008231 CAGCCCCCACACAGAGGCCCAGG - Intronic
961455196 3:127020547-127020569 CTGCCCCAACCCCAGGGCTCAGG - Intronic
962205161 3:133428321-133428343 CCACCCCCAAGCCAGGGCGCTGG + Intronic
962628653 3:137252973-137252995 CCAACCCCACAACAGGCCCCCGG - Intergenic
962793984 3:138834998-138835020 CCGCCGCCACCGCGGGGCCCGGG - Intergenic
963061627 3:141231419-141231441 AAGCACCCACACTAGGGCCCGGG + Intronic
965135672 3:164764237-164764259 CCCACCCCACATCAGGCCCCAGG + Intergenic
966460510 3:180170711-180170733 CCGACCCCACAACAGTCCCCAGG - Intergenic
967198757 3:187052452-187052474 CCAACCCCACAACAGGCCCCAGG + Intronic
967493646 3:190120421-190120443 CCGCCCCCCGGCGAGGGCCCCGG - Exonic
968073257 3:195801425-195801447 CCGCACCCTCCCCGGGGCCCCGG + Intronic
968808788 4:2790898-2790920 CTGGCCCCACACCAGACCCCGGG - Intergenic
968962497 4:3752706-3752728 CCGGCACCACGCCAGGGCCTAGG + Intergenic
969056898 4:4407873-4407895 AGGCCCCAGCACCAGGGCCCAGG - Intronic
969240190 4:5892486-5892508 CTGCCCCAACACCGGGGCCCGGG + Intronic
969379280 4:6783266-6783288 CCGCCCCGACCCCAGGACGCCGG + Intronic
969436991 4:7194019-7194041 CCACCCCCACAAAAGGGCCAAGG + Intronic
969451521 4:7276564-7276586 CCTCCCCCGCTCCAGGCCCCGGG + Intronic
969506889 4:7593650-7593672 CCGCCCCCACCCCCGCCCCCAGG - Intronic
969523816 4:7693985-7694007 CAGCCCACTCACCTGGGCCCCGG + Intronic
971157595 4:24099958-24099980 CCCACCCCACAACAGGCCCCCGG - Intergenic
971257925 4:25030881-25030903 GCGCCCCCCCACCCGAGCCCGGG + Intergenic
971320327 4:25600283-25600305 CCGACCCCACAACAGGCCCCAGG - Intergenic
974654055 4:64796784-64796806 CCACCTGCTCACCAGGGCCCAGG + Intergenic
975368552 4:73556612-73556634 CCGACCCCACAACAGTCCCCAGG - Intergenic
975706091 4:77113237-77113259 CCGGCCCCAGCCCAGGCCCCTGG - Intergenic
976599414 4:86924483-86924505 GAGCCACCACACCAGGGCCATGG + Intronic
979115233 4:116815138-116815160 CGCCTACCACACCAGGGCCCTGG + Intergenic
980419968 4:132546598-132546620 CCACACCCACACCAGGGGTCAGG + Intergenic
980665410 4:135926902-135926924 CCCACCCCACAACAGGCCCCGGG - Intergenic
981319085 4:143370703-143370725 CTGACCCCACAACAGGCCCCGGG + Intronic
981523161 4:145685682-145685704 CCGCCGCCACACCCTGGGCCTGG - Intronic
984747862 4:183240654-183240676 ACGCCTCCACCCAAGGGCCCAGG - Intronic
985469838 5:33381-33403 CACCCCCCACACCAGGTCCATGG + Intergenic
985540490 5:485276-485298 CCACCCCCTCTCCGGGGCCCGGG + Intronic
985558774 5:571006-571028 CCTCCCGCACACCTGTGCCCAGG + Intergenic
985609949 5:881829-881851 CCGCCTCTCCCCCAGGGCCCTGG - Intronic
985638723 5:1053135-1053157 CCTCCCCCACACCAATGCCAGGG + Intronic
985791759 5:1931806-1931828 CCGCCCACTCCGCAGGGCCCGGG + Intergenic
985800873 5:2004787-2004809 CCTGCCCCACACAAGGGCTCCGG - Intergenic
985800906 5:2004910-2004932 CCTGCCCCACACAAGGGCTCTGG - Intergenic
985800917 5:2004951-2004973 CCTGCCCCACACAAGGGCTCTGG - Intergenic
985800948 5:2005075-2005097 CCTGCCCCACACAAGGGCTCTGG - Intergenic
985800992 5:2005238-2005260 CCTGCCCCACACAAGGGCTCCGG - Intergenic
985974348 5:3403918-3403940 CCCACCCCACAACAGGCCCCGGG + Intergenic
986263690 5:6173825-6173847 CCTACCCCACAACAGGCCCCGGG + Intergenic
987626404 5:20406419-20406441 CCTCCCCCACAACAGGCCCCGGG - Intronic
988901477 5:35737368-35737390 CCCACCCCACAACAGGCCCCGGG + Intronic
993828971 5:92729511-92729533 CCACCCCCACCCCATGGCCTTGG + Intergenic
996683455 5:126254135-126254157 CCACCCCAACACCAGAGGCCAGG + Intergenic
996685277 5:126273305-126273327 CCCACCCCACAACAGGGCCCTGG + Intergenic
997809305 5:136952146-136952168 CCCACCCCACAACAGGCCCCAGG - Intergenic
998061275 5:139120634-139120656 CCTGCCCCACACCAGTGCTCAGG + Intronic
999197015 5:149788912-149788934 CCCACCCCACAACAGGCCCCAGG - Intronic
999754609 5:154655063-154655085 CTGCCCCCACACCCAGACCCAGG + Intergenic
1001076940 5:168636856-168636878 CCAACCCCACAACAGGCCCCGGG - Intergenic
1001158586 5:169294426-169294448 CTGCCCCCACAGCAGAGCCCAGG - Intronic
1001481758 5:172093594-172093616 CCGGCCCAACAGCAGCGCCCTGG - Exonic
1001679184 5:173543825-173543847 CAGCCTCCACACCTGTGCCCCGG + Intergenic
1001959751 5:175872679-175872701 CCGTCCCCACCCCGTGGCCCGGG - Intronic
1002086196 5:176777128-176777150 CCGCCCCCACCCCATGCTCCTGG + Intergenic
1002421465 5:179151473-179151495 CTGCCCCCACTGCAGGGCCAAGG + Intronic
1002599546 5:180346465-180346487 CCCCCACCCCACCAGGGCCTCGG + Intronic
1003049469 6:2766240-2766262 CCGCCCGCACCCCCGGGCGCTGG + Exonic
1006168920 6:32081902-32081924 CCGGCCCCACTCCAGGGCTGAGG - Intronic
1006169964 6:32087048-32087070 ACGTCCCCACCCCAGGGTCCTGG - Intronic
1006180162 6:32149652-32149674 CCCCCGCCGCCCCAGGGCCCAGG - Exonic
1006472793 6:34237704-34237726 CCCGCCCCTCACCCGGGCCCGGG - Intronic
1006677948 6:35777278-35777300 CCGGCCCCTCAGCAGGACCCAGG - Intronic
1006678787 6:35782198-35782220 CCGCCCCCAGACCTTTGCCCTGG - Intronic
1006863168 6:37187221-37187243 CGGCCCCCACCCCAGGCCCCAGG - Intergenic
1006880846 6:37338339-37338361 CCCACCCCACAACAGGCCCCAGG + Intergenic
1006882642 6:37353602-37353624 CCGCTCCCACACCTCGCCCCAGG + Intergenic
1007092076 6:39190790-39190812 CTGCCCCCCCACCAGGGGCCAGG + Exonic
1007375642 6:41454891-41454913 CCTCACCCACACCAGGTCTCTGG + Intergenic
1007398847 6:41592244-41592266 CCTCCTCCCCACCAGCGCCCAGG + Intronic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007631434 6:43275430-43275452 CCGCCCCCGCCCCGGGGCCAGGG - Intronic
1007662742 6:43496560-43496582 CGAACCCCAAACCAGGGCCCAGG + Intronic
1007777225 6:44230504-44230526 TCCCCACCACACCAGGGCACTGG - Intronic
1007785275 6:44276206-44276228 CCGCGCCCCCACCGGGCCCCGGG - Exonic
1007785643 6:44277788-44277810 CTGCCACCACCCCAGGGCGCTGG + Exonic
1008397983 6:51031550-51031572 CCCACCCCACAACAGGCCCCTGG + Intergenic
1008658155 6:53637380-53637402 CCCACCCCACAACAGGCCCCTGG + Intergenic
1009921437 6:70066434-70066456 CCCACCCCACAACAGGACCCAGG - Intronic
1010820158 6:80405980-80406002 CCCCGCCCCCACCAGGCCCCAGG + Intergenic
1010877308 6:81123403-81123425 CCCACCCCACAACAGGCCCCGGG + Intergenic
1010945827 6:81971859-81971881 CCGACTCCACAACAGGCCCCAGG + Intergenic
1011254007 6:85402819-85402841 CCAGCCCCATACCCGGGCCCTGG + Intergenic
1012038821 6:94177565-94177587 CCTCTCCAAAACCAGGGCCCAGG - Intergenic
1012219650 6:96633385-96633407 CCACCCTGACACCAGGGCTCTGG + Intergenic
1014652009 6:124051579-124051601 CCGACCCCACAACAGGCCCCGGG + Intronic
1014843214 6:126243768-126243790 CCCACCCCACAACAGGCCCCGGG - Intergenic
1015451569 6:133374342-133374364 CCTCCCCCAAACCAGGGTCCTGG + Intronic
1017164103 6:151391353-151391375 CCACCCCCAGCCCAGGGTCCGGG - Intronic
1017601000 6:156081187-156081209 CCGACCCCATAACAGGCCCCCGG - Intergenic
1017753624 6:157511136-157511158 TTGCCCCCACGGCAGGGCCCTGG - Intronic
1018430273 6:163716582-163716604 CTGCCCCCACACCCTAGCCCTGG + Intergenic
1018904100 6:168065130-168065152 CCCTCCCCACACCAGCTCCCAGG + Intronic
1019008703 6:168824917-168824939 CTGCCCTAACACCAGAGCCCGGG - Intergenic
1019148622 6:169989390-169989412 CCAGCCCCAAACCAGGCCCCTGG + Intergenic
1019437643 7:1030300-1030322 CCGCCTCCACACCTGAGCCCGGG + Intronic
1019476436 7:1246840-1246862 CCGACCCCAGGGCAGGGCCCGGG + Intergenic
1019476645 7:1247605-1247627 CGCCCCCCACACCGGGGCCCGGG - Intergenic
1019485268 7:1286295-1286317 CCCCTCCCACCTCAGGGCCCTGG - Intergenic
1019578013 7:1746766-1746788 CCGCCTCCGCACGAGGGCCTGGG + Exonic
1019588178 7:1815847-1815869 ACGCCCACACACCAGGCTCCGGG + Exonic
1019645212 7:2125231-2125253 CCGCCCCCACCCTTGGGTCCAGG - Intronic
1019747757 7:2710013-2710035 CAGCCACCACACGCGGGCCCTGG - Intronic
1020118901 7:5491914-5491936 CCTCCCCCACACCAGCCTCCCGG - Intronic
1020204666 7:6105242-6105264 CCGCCCCCTCCCCAGCGGCCTGG - Intronic
1020717069 7:11688064-11688086 CCCACCCCACAACAGGCCCCCGG + Intronic
1022095574 7:27139299-27139321 CCTCCCCCGCACCCGGGACCAGG - Intronic
1023586669 7:41738142-41738164 CCGCCCCCGAACCAGTGTCCAGG + Intergenic
1023870762 7:44261978-44262000 CAGCCCCAACTCCAGGGCCCGGG - Intronic
1024226018 7:47327488-47327510 CCGCCCCCACCCCAGTTCCAGGG - Intronic
1024527776 7:50363230-50363252 GAGCCCCCAGACCAGGGCCCTGG + Intronic
1025482246 7:60995204-60995226 CCCCACCCCCACCAAGGCCCAGG + Intergenic
1025877948 7:65506451-65506473 CCCCACCCGCACCAAGGCCCGGG - Intergenic
1025882284 7:65552244-65552266 CCCCACCCGCACCAAGGCCCGGG - Intergenic
1025891158 7:65650358-65650380 CCCCACCCGCACCAAGGCCCGGG + Intergenic
1026037084 7:66837609-66837631 CCACCCCCAAACCAGGGTGCTGG + Intergenic
1026877308 7:73887008-73887030 CGGTCACCACACCAGGGCACAGG - Intergenic
1026903190 7:74048255-74048277 CCTCACCCACCCCAGGGCTCTGG - Intronic
1026911790 7:74095342-74095364 GCCCCCCCACAGCAGGACCCAGG + Intronic
1026973506 7:74481916-74481938 CCCACCCCACAGAAGGGCCCTGG - Intronic
1026984230 7:74544918-74544940 CCACCCCCACACCAGGGTGCTGG - Intronic
1030033475 7:105388993-105389015 CCGCCCCCACCCGCCGGCCCCGG + Intronic
1030176475 7:106660373-106660395 CGGCCCCCGAAGCAGGGCCCGGG + Exonic
1030203519 7:106929585-106929607 CCCACCCCACAACAGGCCCCGGG + Intergenic
1031905872 7:127458945-127458967 CCGCCACCACCCCAGGCCCATGG - Intergenic
1032330283 7:130972748-130972770 CCCACCCCACAACAGGCCCCGGG + Intergenic
1033839476 7:145356588-145356610 CCCACCCCACAACAGGCCCCGGG - Intergenic
1034111002 7:148537452-148537474 TCGCCCCCACCCCATGGCACCGG + Intergenic
1034158962 7:148978445-148978467 TTGTCCCCACATCAGGGCCCAGG + Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034985944 7:155515484-155515506 CCTCCCCCACCCTAGGGACCCGG + Intronic
1035122367 7:156579238-156579260 CCGCCCCCCCACCACCTCCCCGG - Intergenic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035227817 7:157443288-157443310 CCGCCCCCCCACCCCGACCCGGG + Intergenic
1035271326 7:157721788-157721810 CTGCTCCCACCCCAGGGGCCTGG + Intronic
1035305658 7:157929692-157929714 CCGCCCCCACCCGAGGGACAGGG - Intronic
1035350750 7:158244918-158244940 CGGCCCCCACCCCGGGGCACTGG - Intronic
1035356038 7:158276544-158276566 GCACCCCCACACCCTGGCCCTGG + Intronic
1035470327 7:159105243-159105265 TCACCCCCACAGCAGAGCCCAGG + Intronic
1037723021 8:21460533-21460555 GCTCCACCACACCAGTGCCCAGG + Intergenic
1037759625 8:21733316-21733338 CCTACCCCACACCCAGGCCCTGG + Intronic
1037987429 8:23298802-23298824 CCGCCCCCACTCCAGGAAGCAGG - Intronic
1038883495 8:31639641-31639663 CAGCCCCGACAGCAGGGCTCGGG + Intronic
1039030789 8:33307261-33307283 CCCACCCCACAACAGGCCCCGGG - Intergenic
1040315281 8:46257719-46257741 CCGACGCCACACCGTGGCCCGGG - Intergenic
1042436855 8:68775990-68776012 CCACCACCACAGCAGGTCCCAGG - Intronic
1042872678 8:73412551-73412573 AGGTCCCCACACCAGGGCACTGG + Intergenic
1043388094 8:79767831-79767853 CCCCGCCCTCCCCAGGGCCCTGG - Exonic
1044782558 8:95758437-95758459 CCCACCCCACAACAGGCCCCCGG - Intergenic
1046086133 8:109437498-109437520 CCCACCCCACAACAGGCCCCAGG + Intronic
1046871269 8:119208300-119208322 CCGCCCCGTCACGTGGGCCCAGG - Intronic
1048330318 8:133466544-133466566 CTGCTCAGACACCAGGGCCCAGG + Intronic
1048335408 8:133498756-133498778 GGGACCCCACAGCAGGGCCCAGG - Intronic
1049205001 8:141359526-141359548 CCCCCACCACACAAGGGCCCAGG + Intronic
1049256035 8:141614406-141614428 CCTCCCCCTCCCCGGGGCCCAGG + Intergenic
1049392048 8:142376741-142376763 CAGCCCCCATGCCCGGGCCCTGG - Intronic
1049396413 8:142403092-142403114 CCGCCGCCTCACCTGGGCCTCGG + Exonic
1049441391 8:142611405-142611427 CTGCCCCGACACCAGAACCCTGG - Exonic
1049690020 8:143954233-143954255 CCGGCCCAACTCCAGGGCCTGGG + Intronic
1049707810 8:144050927-144050949 CCGCCCCCCTACCAGGGCCCTGG + Intergenic
1049708429 8:144053181-144053203 CCGCCCACACTCCTGTGCCCAGG + Intronic
1049796275 8:144498626-144498648 CTGCCCCCACCCCTGGGCTCTGG + Intronic
1050462195 9:5886344-5886366 CAGCCCCCACACCAGCCCCAGGG - Intronic
1050887899 9:10788864-10788886 CCCACCCCACAACAGGCCCCGGG + Intergenic
1052039630 9:23723407-23723429 CCGTCCCCACAACAGTCCCCAGG - Intronic
1052745833 9:32440382-32440404 CCCCGCCCTCACCAGGGCTCAGG + Intronic
1052852252 9:33385405-33385427 ACACCCCCAACCCAGGGCCCTGG + Intronic
1053005319 9:34600445-34600467 CCGCCCCCACACCTGGACCCAGG + Intergenic
1053129200 9:35605632-35605654 CGGCCCCCACTGCGGGGCCCTGG + Exonic
1053175241 9:35917741-35917763 CAGGCCCCACACCAGGGCTGTGG - Intergenic
1056015802 9:82386333-82386355 CCAACCCCACAACAGGCCCCGGG + Intergenic
1057048509 9:91904188-91904210 GCACCACCACACCCGGGCCCAGG + Intronic
1057072867 9:92115268-92115290 CCGCGACCACACCCGGGCCCGGG - Intronic
1057168833 9:92948782-92948804 CTGCCCCAACACAAGGGCCTGGG - Intronic
1059262753 9:112994113-112994135 GAGCCCACACACCAGGGCCTTGG - Intergenic
1059455035 9:114394985-114395007 CCGCTCCCACACCAGCCCCTAGG - Intergenic
1060795011 9:126507384-126507406 GCGCCCCCAGACAAGGGCTCTGG - Intergenic
1060827322 9:126694615-126694637 CCTCCCTCTCACCAGGGCGCAGG - Intronic
1061190077 9:129077493-129077515 CAGCCCCCACATCAGGAACCAGG - Intergenic
1061304460 9:129724368-129724390 CCTCCCCCAGTCCAGGGCACAGG - Intergenic
1061429509 9:130522458-130522480 CCTCCCCCACACCCTGACCCTGG + Intergenic
1061449489 9:130660680-130660702 CCTCCCCCGCACCCAGGCCCGGG + Intergenic
1061559655 9:131394281-131394303 CCGCCCCCACGCCCCGGCCCCGG - Intronic
1061610261 9:131740921-131740943 GAGACCCCACACCAGGGCCTGGG + Intergenic
1061817722 9:133206620-133206642 CCGGCCCCACCCCAGAGCTCTGG - Intronic
1061820261 9:133223473-133223495 GCCCCCACACCCCAGGGCCCGGG - Intergenic
1061928953 9:133822380-133822402 CTGCCCCCACCCCAGTCCCCTGG - Intronic
1062035200 9:134379822-134379844 CCCCTCCCACACAAGGCCCCAGG - Intronic
1062037976 9:134391137-134391159 CCGGCCCCATGCCAGGCCCCAGG + Intronic
1062240372 9:135534431-135534453 GCCCCCACACCCCAGGGCCCGGG + Intergenic
1062243605 9:135552404-135552426 CTTCCCCCACACAAGGGCTCTGG + Intergenic
1062277049 9:135736177-135736199 CCCACCCCACACCAGGGCTGGGG + Intronic
1062337318 9:136077730-136077752 CCACCCCCACACCGGGGAGCAGG + Intronic
1062372750 9:136248556-136248578 CCGCCACCACCCCCAGGCCCAGG - Intergenic
1062488027 9:136790962-136790984 CCGCCCCCAATCCAAGGCCCTGG + Intergenic
1062537012 9:137025484-137025506 CCGCCCCCACCCCAGGGACCGGG - Intronic
1062555551 9:137112120-137112142 CGGCCCCGACGCCAGGGCCTGGG - Exonic
1062607111 9:137353327-137353349 CTGCCCCCACCCCGGGTCCCAGG + Intronic
1203613641 Un_KI270749v1:30789-30811 CCCCACCCCCACCAAGGCCCGGG + Intergenic
1185479560 X:435792-435814 CCTCACCCACACCCGGGACCTGG - Intergenic
1186187928 X:7040172-7040194 CCACCCCCACACCAGTGCCCAGG - Intergenic
1186611091 X:11139125-11139147 CCGCCTCCATACCCGGGCCCAGG - Exonic
1186670018 X:11758408-11758430 CCGCCCCCGCCCCCGGTCCCGGG - Intronic
1187481261 X:19657905-19657927 CCGCCCCCACCCCCAGCCCCTGG - Intronic
1188916419 X:35917074-35917096 CCCACCCCACAACAGGCCCCAGG - Intergenic
1189304377 X:39975595-39975617 CCACCCCCACTCCAGGGCAGTGG + Intergenic
1189765080 X:44363093-44363115 CCCACCCCACAACAGGCCCCAGG - Intergenic
1190734050 X:53243538-53243560 CCACCCCCACACCCAGGCACGGG + Intronic
1191015545 X:55806220-55806242 CCCACCCCACAACAGGCCCCAGG + Intergenic
1191032246 X:55987355-55987377 CCAACCCCACAACAGGCCCCGGG + Intergenic
1191792727 X:64987889-64987911 CCCACCCCACAACAGGCCCCAGG + Intronic
1191956213 X:66644987-66645009 CCCACCCCACAACAGGCCCCGGG + Intergenic
1192359873 X:70432703-70432725 CAGCCTCATCACCAGGGCCCTGG - Intronic
1194051669 X:89077074-89077096 CCCACCCCACAACAGGCCCCGGG - Intergenic
1195034075 X:100955113-100955135 CCACGCCCACACCAGTGGCCAGG - Intergenic
1196625055 X:117868891-117868913 CCTCCCACACAGCAGTGCCCAGG - Intergenic
1197774376 X:130110229-130110251 CCAGCCCCACGCCGGGGCCCCGG + Intronic
1198178124 X:134175053-134175075 CCTCCCCCAGACCACAGCCCAGG + Intergenic
1199334725 X:146605502-146605524 CCCACCCCACAACAGGCCCCCGG + Intergenic
1200267912 X:154655681-154655703 CCTCCCCTACACCTGGGGCCTGG - Intergenic
1200832966 Y:7705198-7705220 CCCACCCCACAACAGGCCCCAGG + Intergenic
1202041456 Y:20689636-20689658 CCTACCCCACAACAGGCCCCAGG + Intergenic