ID: 1132630307

View in Genome Browser
Species Human (GRCh38)
Location 16:914158-914180
Sequence CCTCCTAGGAGGGGTCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132630307_1132630319 8 Left 1132630307 16:914158-914180 CCACCCCGACCCCTCCTAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1132630319 16:914189-914211 CATCTCCACCACTGCAACCTGGG 0: 1
1: 1
2: 2
3: 37
4: 266
1132630307_1132630323 28 Left 1132630307 16:914158-914180 CCACCCCGACCCCTCCTAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1132630323 16:914209-914231 GGGCAGTCCCTGACCCCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 269
1132630307_1132630318 7 Left 1132630307 16:914158-914180 CCACCCCGACCCCTCCTAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1132630318 16:914188-914210 ACATCTCCACCACTGCAACCTGG 0: 1
1: 1
2: 3
3: 16
4: 174
1132630307_1132630324 29 Left 1132630307 16:914158-914180 CCACCCCGACCCCTCCTAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1132630324 16:914210-914232 GGCAGTCCCTGACCCCTCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132630307 Original CRISPR CCTCCTAGGAGGGGTCGGGG TGG (reversed) Intronic
900545966 1:3229364-3229386 CCACCTAGGGGAGGCCGGGGAGG - Intronic
900789943 1:4673205-4673227 GCTCATAGGTGGGGTTGGGGGGG + Intronic
903163013 1:21502846-21502868 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
904239472 1:29134571-29134593 ACCCCTGGGAGCGGTCGGGGTGG + Intergenic
904284464 1:29445051-29445073 CCTCCCAGGAGGGGAGGGGAGGG - Intergenic
904368876 1:30035901-30035923 CCTCCCAGGAGGGGAGGGGAGGG - Intergenic
904593179 1:31626675-31626697 CTGCCTATGAGGGGGCGGGGAGG - Intronic
905202582 1:36324037-36324059 CCTCCTAGGAGGGGGAGCGGTGG - Exonic
905262251 1:36728163-36728185 CCTCCAGGGAGTGGTGGGGGTGG - Intergenic
905402929 1:37716407-37716429 CTTCCCAGGAGGGGTGGGGAAGG + Exonic
905638977 1:39575966-39575988 CCTCCTGGCGGGGCTCGGGGTGG - Exonic
905648281 1:39639699-39639721 CCCCCGAGGCGGGGCCGGGGCGG - Exonic
906145487 1:43557986-43558008 CCTCCTAGGAGGGAGGGGAGGGG - Intronic
907436143 1:54449545-54449567 GCTCAGAGGAGGGGTCTGGGTGG - Intergenic
908477640 1:64505546-64505568 CCCCAGAGGAGGGGGCGGGGCGG - Intronic
908929249 1:69297322-69297344 CCTCATAGGATGAGTTGGGGAGG + Intergenic
909882794 1:80901188-80901210 CCTCATAGGATGAGTTGGGGAGG - Intergenic
909990993 1:82222391-82222413 CATCCTAGCAGGGGGCAGGGTGG + Intergenic
912639092 1:111327363-111327385 CCTCATAGAATGGGTTGGGGAGG + Intergenic
913068961 1:115283131-115283153 CCTCCAAGGAGCGGACAGGGCGG + Intergenic
915305598 1:154975700-154975722 CCTCCAAGGCGGTGGCGGGGCGG - Intronic
915545741 1:156596475-156596497 CCATCTAGGAGGGGTCATGGGGG + Exonic
917200623 1:172510690-172510712 CCTCTTAGTAGAGGTCAGGGAGG + Intergenic
920191467 1:204196656-204196678 CCGCCTCGGAGGGCTCGGGTGGG - Intergenic
923198818 1:231692462-231692484 TCTCCTAAAAGGGGTGGGGGTGG - Intronic
1063415569 10:5870242-5870264 CCTCCGTGAAGGGGTCGGTGAGG - Intronic
1064778279 10:18804640-18804662 CATCCTAGGAGGTGTGGAGGAGG - Intergenic
1065603496 10:27393132-27393154 CCTCCTGGAAGGGGTAGGGGTGG - Intergenic
1067026424 10:42847306-42847328 CCTCCCAGACGGGGTCGCGGTGG - Intergenic
1067315789 10:45160851-45160873 CCTCCTAGGAGGTTGAGGGGTGG - Intergenic
1070823408 10:79376122-79376144 GGTTCTGGGAGGGGTCGGGGGGG + Intergenic
1070922109 10:80194509-80194531 ACTCCTAGGAAGAGTCGGGGGGG + Intronic
1075083169 10:119397257-119397279 GCCCCGAGGTGGGGTCGGGGTGG - Intronic
1076305867 10:129465683-129465705 CATCCAAGGCAGGGTCGGGGTGG + Intergenic
1076502156 10:130945684-130945706 CCTCCCTGGAGGGGTGGGGGTGG + Intergenic
1076701984 10:132278020-132278042 CCTCCAGGGAGAGGTGGGGGTGG + Intronic
1076707111 10:132308035-132308057 GCTCCTGGAAGGGGTCGAGGCGG + Intronic
1076719377 10:132386601-132386623 CTTCCAAGCAGGGGTCTGGGTGG - Intergenic
1077034028 11:486284-486306 CATGCGGGGAGGGGTCGGGGTGG + Intronic
1077122215 11:914819-914841 GCTCCTGGGTGGGGTCGCGGCGG + Intronic
1077390797 11:2299956-2299978 GCTCCTTGGTGGGGTAGGGGTGG + Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1083596031 11:63918628-63918650 CCACTTAGGAGGGGTCGGCCTGG - Intergenic
1083674130 11:64316118-64316140 CCCCCTAGGAGGGGGAGGAGAGG - Exonic
1083902948 11:65652564-65652586 CCTGGGAGGCGGGGTCGGGGAGG - Intergenic
1084009116 11:66338009-66338031 CCACTCAGGAGGGGTCAGGGAGG - Intronic
1084045311 11:66564677-66564699 ACTCCAAGAAGAGGTCGGGGAGG + Intronic
1084386116 11:68843600-68843622 CCTAAAAGGAGGGGTGGGGGAGG + Intronic
1085402828 11:76244720-76244742 CAGCCTGGTAGGGGTCGGGGTGG - Intergenic
1087713665 11:101583202-101583224 CCTCCTAGGACGGTGCTGGGAGG - Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1091177990 11:133579214-133579236 ACGTCTAGGTGGGGTCGGGGCGG + Intergenic
1091704384 12:2683943-2683965 CATGCTGGGAGGGGTCGGTGAGG - Intronic
1091750837 12:3020480-3020502 CCTCCTAGCAGAGGTGGTGGAGG - Intronic
1091795517 12:3295536-3295558 CCTCCAAGCAGGGGCCCGGGAGG + Intergenic
1091953322 12:4613900-4613922 CCTCTTATGAGGGATGGGGGAGG + Exonic
1092850015 12:12618342-12618364 CCTCCTAGACGGGGTGGCGGTGG + Intronic
1094059453 12:26298027-26298049 CCTCCTAGGTGATGTGGGGGAGG - Intronic
1096650330 12:53059270-53059292 CCTCCTAGGAGGCTGCGGAGTGG + Exonic
1100048210 12:90411138-90411160 CCTCCCAGGCGGGGTGGCGGCGG - Intergenic
1101317216 12:103640366-103640388 CCTACTATGTGGGGTGGGGGTGG - Intronic
1101328248 12:103735776-103735798 CCTGCTAGGAGGGCTTGGGTTGG - Intronic
1101479558 12:105084198-105084220 CCTCAGAGGAGGGCTTGGGGAGG - Intronic
1101541369 12:105668687-105668709 CCTCCAAAGAGGGGATGGGGAGG + Intergenic
1102111015 12:110365941-110365963 CCTCCTAGGGGAGGCCAGGGAGG - Intergenic
1102656307 12:114485005-114485027 CCTCCCAGACGGGGTCGTGGCGG + Intergenic
1106450531 13:29877866-29877888 TCTCCTAGGCGTTGTCGGGGAGG - Intergenic
1108571766 13:51758791-51758813 CCTCCAAGAATGGGTCAGGGAGG - Intronic
1112534223 13:100234693-100234715 CCTCCGAGAAGGGGGCGGGGGGG - Intronic
1114084546 14:19229790-19229812 CCTGGTGGGGGGGGTCGGGGGGG + Intergenic
1119553343 14:75533650-75533672 CTTCCTAGGAGGGGTGGGTTGGG + Intronic
1121733877 14:96204859-96204881 GCTCCGAGGAGGGGTGGGGACGG + Exonic
1122246869 14:100409420-100409442 CTTCCTGGGATGGGTGGGGGGGG - Intronic
1122663368 14:103312360-103312382 CCTCCTAGAAGGAGCTGGGGAGG - Intergenic
1122783523 14:104153645-104153667 CATCCTGGGAGGGGTGGGCGGGG + Intronic
1123439519 15:20280626-20280648 CCTCCTGGGACGGGGCTGGGAGG + Intergenic
1124688051 15:31798986-31799008 CCTTCAAGGAGGGGCCAGGGTGG + Intronic
1126538436 15:49794849-49794871 CCACCTACCAGAGGTCGGGGAGG + Intergenic
1128970117 15:72100644-72100666 CCTCCCAGACGGGGTCGTGGCGG - Intronic
1129082412 15:73052465-73052487 CCTCCTGCAAGGGGGCGGGGAGG - Exonic
1129324553 15:74793320-74793342 AAGCCTAGGAGCGGTCGGGGTGG - Intronic
1129827140 15:78641320-78641342 CCACCCAGGGGGCGTCGGGGCGG - Intronic
1130095135 15:80850166-80850188 GCACATAGGAGGGGTCGGAGAGG + Intronic
1130601895 15:85281240-85281262 TCTCCTAGGAGGGCCGGGGGAGG - Intergenic
1130767012 15:86880927-86880949 TCTCCTAGGAGGGCCAGGGGAGG + Intronic
1130865592 15:87930679-87930701 CCTCCCAGGAAGGGTTGGTGCGG + Intronic
1131277354 15:90993658-90993680 CTTCCTAGGCGGTGTTGGGGAGG - Intronic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1132663767 16:1072730-1072752 CCGGCTGGGAGGGGGCGGGGCGG - Intergenic
1132844644 16:1994349-1994371 CCCCACAGGAGGGGACGGGGAGG + Intergenic
1133028506 16:2998779-2998801 CCTCCTGGGTGGCGTCGGTGAGG + Intergenic
1133051609 16:3120307-3120329 CCTCCTAGGTGGGAGCGGGTGGG - Exonic
1133156789 16:3881157-3881179 CCTCCTAGGTGGCGTCGGTCGGG + Intergenic
1133239997 16:4408540-4408562 TGCCCTAGGAGGGGTCGGGCTGG - Intronic
1136233929 16:28903280-28903302 CCTCTCAGGAGGGGGTGGGGAGG - Intronic
1138132819 16:54496142-54496164 CTTCGTAGGAGTGGTCAGGGAGG + Intergenic
1140406358 16:74714002-74714024 CCTCCTACCAGGGGTCAGGAGGG + Exonic
1142151843 16:88516068-88516090 CCTCCTCGTAGGGTGCGGGGAGG - Intronic
1142256816 16:89017775-89017797 CGTCCGAGGACGGGGCGGGGAGG - Intergenic
1142607529 17:1090381-1090403 CCTCTAAGGAGAGGTGGGGGTGG + Intronic
1142743117 17:1942064-1942086 CCACCCAGGAGGGGACGAGGAGG - Intronic
1142981899 17:3677255-3677277 CCTCTGAGGAGGGGTGGGGAGGG + Intronic
1144048012 17:11470704-11470726 CTTCTGAGGAGGGGTGGGGGTGG + Intronic
1145244313 17:21258261-21258283 GCTTGAAGGAGGGGTCGGGGTGG + Intergenic
1146521376 17:33528107-33528129 CCTCGTAGGAGGTGGCAGGGAGG + Intronic
1146791010 17:35750483-35750505 CCCCCTAGGAGGGGTCTGGGCGG + Intronic
1147040404 17:37713867-37713889 CATCTTATGAGGGGGCGGGGTGG + Intronic
1147360687 17:39927696-39927718 ACTCCCAGGAGGCGTCGGGAGGG - Intergenic
1147969845 17:44213346-44213368 CCAGCGAGGAGGGGTCTGGGTGG - Intronic
1148378076 17:47168224-47168246 CCTCCTGGGAGGTTGCGGGGTGG + Intronic
1148579412 17:48733305-48733327 CCGCCAACGAGGGGTGGGGGCGG + Intergenic
1148841318 17:50499418-50499440 CATCCTAGTGGGGGTTGGGGGGG - Intergenic
1150389831 17:64783841-64783863 CCCCCAGGGAGGGGTGGGGGTGG + Intergenic
1150397045 17:64830127-64830149 CCTCCTGGGAGTGGGTGGGGTGG + Intergenic
1150441502 17:65195226-65195248 TGTCCTAGGAGGGCTTGGGGAGG + Intronic
1152211666 17:79005615-79005637 CCTCCTTGGAAGGGACGGGTAGG + Intronic
1152654951 17:81515018-81515040 GCGCCTCCGAGGGGTCGGGGCGG + Intronic
1152926372 17:83089592-83089614 CCTCCTCGGAGGGGGAGGGCTGG - Intronic
1152940834 17:83172302-83172324 CCTCCTAGGTGGGGTGGGACGGG + Intergenic
1153023998 18:657568-657590 CCTGCTCGGCGGGGTCGCGGCGG - Intronic
1153126131 18:1793055-1793077 CCGTCTCGGCGGGGTCGGGGGGG - Intergenic
1154476794 18:14768100-14768122 CCTCCTAGGAGGTTGAGGGGTGG - Intronic
1155392072 18:25349509-25349531 TCTCCTGGGAAGGGACGGGGTGG - Intronic
1158241072 18:55379203-55379225 CATCTTAGCAGGGGTCGGGTAGG + Intronic
1159606756 18:70482425-70482447 CCTCATAGGATGAGTTGGGGAGG + Intergenic
1160233491 18:77067208-77067230 CCTCCCAGAAGGGGGCGGGGGGG - Intronic
1160739581 19:679802-679824 TCCCCCAGGAGGCGTCGGGGAGG - Intronic
1160832265 19:1109491-1109513 CCTACAAGGTGGGGTCGGGCGGG - Exonic
1161033486 19:2071142-2071164 CTTCCCAGGTGGGCTCGGGGAGG - Exonic
1161273819 19:3404593-3404615 CCTCCTGGGTGGGGTGGGGGTGG - Intronic
1161314930 19:3613316-3613338 CCTCCGAGGAGGGCCCGGGCGGG + Exonic
1162034689 19:7932592-7932614 CCGCCTGGGAGGGGTCCTGGGGG + Intronic
1162497964 19:11034076-11034098 CCGCTGAGGAGGGGCCGGGGTGG - Intronic
1164305709 19:24002826-24002848 CCTCCAAGGAGGAGGAGGGGTGG + Intergenic
1166120081 19:40681054-40681076 GATCCTAGGAGGGGCCGGGGAGG + Exonic
1166599054 19:44077879-44077901 CCCCCGAGGAGGGGTCAGGGAGG - Intronic
1166830848 19:45638944-45638966 CCTCCGGGGAGCGGTGGGGGTGG - Intronic
1166957135 19:46472050-46472072 CATGCTAGAAGGGGTCGGGGAGG - Intergenic
1167011725 19:46813190-46813212 CCTCCCAGGAGGGGCCTGGAGGG + Intergenic
925262879 2:2543255-2543277 CCACCTCGGAGGGGCCGTGGGGG - Intergenic
927720084 2:25376924-25376946 CCTCCTCGGAGAGGGCGGGAGGG - Intergenic
929777909 2:44939830-44939852 CCTCCTTGGAGGATTCCGGGCGG - Intergenic
929966855 2:46542879-46542901 CCTCGCAGGAGGGGAGGGGGCGG - Exonic
930358196 2:50346799-50346821 CCTCCTAGGAGTGGCGTGGGGGG - Intronic
930363583 2:50411594-50411616 CCTCCCAGAAGGGGTGGCGGTGG - Intronic
931587256 2:63841669-63841691 CGCCCAAGCAGGGGTCGGGGAGG - Intronic
932120531 2:69095608-69095630 CCACCATGGAGGGGTTGGGGAGG + Intronic
932254550 2:70273087-70273109 CTCCCTGGGAGGGGGCGGGGTGG - Intronic
932511954 2:72301357-72301379 CCTCATAGAAGGAGTTGGGGAGG + Intronic
935500305 2:103830918-103830940 CCACCTAGGAGGAGTGGGAGTGG + Intergenic
937129858 2:119501463-119501485 CCTGCTGGGAAGGGTGGGGGAGG + Intronic
937955878 2:127421543-127421565 CCTCTTAGGAGTTGTGGGGGTGG + Intronic
938195039 2:129319434-129319456 CCTCCTAGGAGGGCTCCTGCTGG + Intergenic
938773591 2:134521813-134521835 CCTCCTAGGAGGGGTTATGCAGG - Intronic
939494487 2:142912057-142912079 CTTCCTAGAATGAGTCGGGGAGG + Intronic
940092520 2:149936718-149936740 CCTCCTTGAATGGGTCTGGGTGG - Intergenic
941987418 2:171522748-171522770 CCTCCTGGGGGGGTGCGGGGAGG + Intronic
943411697 2:187556584-187556606 CCTCCCAGACGGGGTCGCGGCGG - Intronic
945185276 2:207133729-207133751 CCTCTTAAGAGGGGGAGGGGGGG + Intronic
948641740 2:239379518-239379540 GCTCCCAGGAGGGGTCTGGCAGG + Intronic
948750095 2:240127231-240127253 CTTCCTGGTAGGGGTGGGGGTGG - Intronic
948763262 2:240205554-240205576 CCTCCTGGGAGGGGCGGGGCAGG - Intergenic
948824208 2:240566554-240566576 CCTCCTCGGGCGGGGCGGGGCGG + Intronic
1169218011 20:3804479-3804501 CCTCAAAGGAGGGGACGTGGGGG + Intronic
1170422200 20:16204233-16204255 GCTCCTAGGAGGGGGTGGGCTGG + Intergenic
1170871921 20:20213925-20213947 CTTCATATGAGGGGGCGGGGAGG - Intronic
1171452680 20:25247448-25247470 CCTCCGAGGCGGGGTCGTGGTGG + Intergenic
1171464754 20:25319700-25319722 CCTCCGAGGAGGGGTCATAGTGG - Intronic
1172092782 20:32445870-32445892 CCCCCAAGGAGGGATGGGGGGGG - Exonic
1172115543 20:32571582-32571604 CCTCCTAGGAGGGGCAAGGTGGG - Intronic
1172792168 20:37513343-37513365 CCTCCAAGGAGGGGGCAGGCAGG - Intronic
1174371199 20:50089309-50089331 CCTCCAAGGAGGGGGCTTGGCGG + Intronic
1174418731 20:50385417-50385439 CCTCCTCGGAGGGTGGGGGGAGG - Intergenic
1175141228 20:56861522-56861544 CCTCGTAGGAGGGGTGGAGATGG + Intergenic
1180090806 21:45533102-45533124 CCTCCTGGGAGGGTGCAGGGCGG - Intronic
1180496230 22:15892827-15892849 CCTGGTGGGGGGGGTCGGGGGGG - Intergenic
1180796655 22:18609059-18609081 CCTCCTCTGAGGGGTCGATGTGG - Exonic
1181225069 22:21386212-21386234 CCTCCTCTGAGGGGTCGATGTGG + Exonic
1181253563 22:21548601-21548623 CCTCCTCTGAGGGGTCGATGTGG - Exonic
1182144460 22:27988755-27988777 CAGCCACGGAGGGGTCGGGGCGG - Intronic
1182822212 22:33226467-33226489 CCTCCTGGGAAGGGACAGGGTGG - Intronic
1183360318 22:37379919-37379941 CCTCCGAGGGGGGGCAGGGGTGG - Intronic
1183391038 22:37545891-37545913 CCTCCACGGAGGGGTGGGGCTGG - Intergenic
1183981744 22:41544528-41544550 CCGCCTCGGCGGGGTGGGGGTGG - Intronic
1184038529 22:41929794-41929816 CCTCCTAAATGGGGTGGGGGTGG + Intergenic
1184243489 22:43223562-43223584 CTTCCTGGGAGGGGCCGTGGGGG + Intronic
1184696017 22:46139541-46139563 CCTCCTGGGACGGGGCTGGGAGG + Intergenic
1184713600 22:46267973-46267995 CTTCCTGGGAGTGGGCGGGGCGG - Exonic
1184923448 22:47621600-47621622 AATTCTAGGAGGGGTTGGGGTGG + Intergenic
1185202497 22:49516810-49516832 ACTCTTAGGAGGGGACGGGAGGG - Intronic
1185238286 22:49727109-49727131 CCTCCTTAGCGGGGTGGGGGTGG + Intergenic
953031225 3:39181063-39181085 CCGCCGAGGAGGGGCGGGGGCGG - Intergenic
954031810 3:47825159-47825181 CTTCCTTGGTGTGGTCGGGGTGG - Intronic
956379626 3:68651854-68651876 CCTCCTTGGCAGGGTCGGGAGGG + Intergenic
958161040 3:89817371-89817393 CCTCCTAGGATGAGTTAGGGAGG - Intergenic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
961819482 3:129567933-129567955 CCTCCTGGGCAGGGTTGGGGTGG + Intronic
963925719 3:150948841-150948863 CCTCCTAGAATGAGTTGGGGAGG - Intronic
965283170 3:166780485-166780507 CCTCCTAGAATGAGTCAGGGAGG + Intergenic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
975492651 4:75005593-75005615 CCTGCTAGGAGGGATGTGGGGGG - Intronic
977933947 4:102779655-102779677 CTTCCAAGGAGGGTTCCGGGAGG + Intergenic
978163604 4:105579740-105579762 CCTCATAGCAGGAGTTGGGGAGG + Intronic
984923407 4:184785591-184785613 CCTCCTGGGCGGGGGCGGGGGGG + Intronic
985727428 5:1523619-1523641 CGGCCGAGGAGGGGCCGGGGAGG - Intronic
987368004 5:17167196-17167218 TCTCCGAGGCGGGGTTGGGGAGG + Intronic
992726426 5:79612329-79612351 GCTCATAGGCGGGGTGGGGGGGG + Intronic
993934907 5:93987224-93987246 CCTCCTAGAAGGAGTAGGGTGGG + Intronic
995027888 5:107445666-107445688 CATCCTTGGAGAGGTCTGGGTGG - Intronic
996877816 5:128259490-128259512 CCTCCTAGGGGAGCTTGGGGAGG - Exonic
997199882 5:132003492-132003514 CCTCCCAGGAGCGGCAGGGGAGG + Intronic
997590098 5:135067124-135067146 CCAGGGAGGAGGGGTCGGGGAGG - Intronic
997590111 5:135067157-135067179 CCGGCAAGGAGGGGTCAGGGAGG - Intronic
998230935 5:140361061-140361083 AATCCTAGGAGGGGTAGGGATGG - Intronic
998969283 5:147574067-147574089 CCTGCTATGAGGGGTGGGGTTGG + Intergenic
999191053 5:149747791-149747813 CCTCCCTGGTGGGGTGGGGGTGG + Intronic
1002311148 5:178314503-178314525 CCTGTTAGGAGGGGCTGGGGTGG + Intronic
1005806693 6:29479893-29479915 CCTTCTAGGATGGGTTGGGCTGG - Intergenic
1006273275 6:32980824-32980846 TCTCCTAGAGGGGGGCGGGGGGG - Exonic
1006826928 6:36941949-36941971 CCTCCCAGAAGGGGTGGCGGCGG - Intergenic
1006929928 6:37681339-37681361 TCTCCTAGGAAGGGTGGTGGGGG + Intronic
1006932921 6:37698367-37698389 CCTGCTGGGCGGGGTTGGGGGGG - Intronic
1010295468 6:74191309-74191331 CCTCCTAGAATGAGTTGGGGAGG + Intergenic
1015252826 6:131144281-131144303 CCTCCCAGACGGGGTCGTGGCGG + Intronic
1018372383 6:163179939-163179961 CCTCCCAGGAGGGCTCGGCTGGG - Intronic
1018644254 6:165932890-165932912 TCTCCTTGGAGGGGTTGTGGAGG - Intronic
1019576632 7:1740718-1740740 CCTCCTGTCAGGGGCCGGGGGGG - Intronic
1019657918 7:2207413-2207435 CCTCCTAGGAGGTTGAGGGGTGG - Intronic
1020106594 7:5424973-5424995 CCTCCCTGGAGGGGGCGCGGCGG - Intronic
1020289772 7:6714552-6714574 CCTCCTAGGATGGGGTGGGGTGG - Intergenic
1021927542 7:25547700-25547722 CCTCCTAGGAGGGTCCTCGGAGG - Intergenic
1023011044 7:35925029-35925051 CCTCATAGGATGGGTGGGGCAGG + Intergenic
1023798336 7:43811940-43811962 CCCACAAGGAGGGGTGGGGGAGG + Intergenic
1023862518 7:44224960-44224982 CCTCCTGGGAGGGGCTGGGCAGG - Intronic
1024133012 7:46375731-46375753 CTTCCTGGTGGGGGTCGGGGTGG - Intergenic
1025124676 7:56335131-56335153 CCTCATAGGATGGGTGGGGCAGG + Intergenic
1027987229 7:85308704-85308726 CTTCCTAGTATGGGTGGGGGTGG + Intergenic
1028979811 7:96954803-96954825 TCTCCTAGGAGAGGCAGGGGAGG + Intergenic
1029382898 7:100225081-100225103 CCTCCCAGGAAGGCTCTGGGTGG + Intronic
1029384061 7:100232048-100232070 CCACCTGGCAGGGGGCGGGGTGG + Intronic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1032174346 7:129611684-129611706 CCGCCGAGGAGGGGGAGGGGAGG - Intergenic
1033597943 7:142869997-142870019 CAACCTGGGAGGGATCGGGGTGG - Intronic
1034466425 7:151232629-151232651 CGTCCCGGGAGGGGGCGGGGCGG - Exonic
1035216503 7:157371533-157371555 CCTCCCAGGAGAGGTCGCGGAGG + Intronic
1036177953 8:6557023-6557045 CCACCTAGGAGGGGTGGGCGGGG + Intronic
1036562181 8:9906718-9906740 CCGCCCAGGCGGGGTGGGGGAGG - Intergenic
1036655006 8:10672155-10672177 CCTAATAGGAGGAGTCAGGGAGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038425407 8:27461241-27461263 CCTCAAAGGAGGGGCCGTGGGGG - Exonic
1038596265 8:28889673-28889695 CCTCCTGGGAGGGATGGGGTGGG + Intronic
1039201031 8:35094386-35094408 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
1039480825 8:37872128-37872150 CCTCCTGGGAGGGGAGGAGGAGG + Exonic
1040065603 8:43141308-43141330 CCGCCTGGGAGGGGCCGGGCTGG + Intronic
1043559644 8:81476982-81477004 CCTCCTATGAGGGTTGTGGGTGG + Intergenic
1045231484 8:100310423-100310445 CCTCCAAGGACAGGTCGGGGTGG + Intronic
1046094306 8:109539657-109539679 CCTTCAAGGAGGGCTGGGGGCGG + Intergenic
1046735845 8:117776523-117776545 CCTCGTAGAATGGGTAGGGGAGG - Intergenic
1048368314 8:133757432-133757454 CCTCCTAGGTGGGATGGCGGTGG - Intergenic
1048445402 8:134489339-134489361 CCTCCTAGAATGGGTTGAGGGGG - Intronic
1049305490 8:141900601-141900623 CCTCATATGAGGGGAGGGGGAGG + Intergenic
1049512727 8:143037905-143037927 CCTCCTAGGTGGAGTCAGGGTGG - Intergenic
1049791554 8:144474801-144474823 CCTGCTAGGAGGGTCCGGGGAGG - Exonic
1052301426 9:26956717-26956739 TCTCCTGCGGGGGGTCGGGGAGG - Intronic
1052796952 9:32931571-32931593 CCTCCCAGGAGGGATCTGGGCGG - Intergenic
1056915301 9:90740912-90740934 CCTTCTAGCAAGGGTGGGGGTGG + Intergenic
1057921755 9:99104278-99104300 CCTCCTTTGAGGGGTTGGGGTGG + Intronic
1059234487 9:112750675-112750697 CCGCCCGGGAGGGGGCGGGGAGG - Intergenic
1059847234 9:118293802-118293824 TGTCCTAGAAAGGGTCGGGGGGG + Intergenic
1061237601 9:129351711-129351733 CCACCAAGGCGGGGGCGGGGGGG - Intergenic
1061677512 9:132226751-132226773 CCTCCCAGGAGGGGCCCAGGAGG - Intronic
1061682444 9:132249744-132249766 CCTCCTAGCAGGTTTTGGGGAGG - Intergenic
1061816868 9:133202533-133202555 CCTCCTAAGTAGGGTTGGGGAGG - Intergenic
1185877746 X:3713724-3713746 GCTCCTGGGCTGGGTCGGGGCGG - Intergenic
1187532614 X:20110548-20110570 GCTCCTTGGAGGGGTTGAGGTGG + Intronic
1188180668 X:27051144-27051166 CCTCCCAGGAGGGGTTGAGTGGG + Intergenic
1188205778 X:27355963-27355985 CCTCCTTGGGGGTGGCGGGGCGG - Intergenic
1188834250 X:34936892-34936914 CCTCATAGAATGGGTTGGGGAGG - Intergenic
1189968649 X:46396387-46396409 CCTCCCAGATGGGGTCGCGGCGG + Intergenic
1190333658 X:49250234-49250256 CCTCCTAGGCCGGGTCCGGGAGG + Exonic
1190380491 X:49836353-49836375 CCTCCAGGGAGGGGATGGGGAGG - Intergenic
1191747408 X:64504504-64504526 CCTCCTAGAATGAGTTGGGGAGG - Intergenic
1195005136 X:100678403-100678425 CTTCCTGGGAGGGGTCAGGCTGG - Exonic
1195702641 X:107716551-107716573 CATCCTGGGAAGGGGCGGGGGGG - Intronic
1196873072 X:120131093-120131115 CCTCCTACGAGGGGTTGAGTGGG - Intergenic
1200032359 X:153306911-153306933 GCTCCTATGAGGGGGCAGGGTGG - Intergenic
1200124483 X:153806840-153806862 CCTGCCACGAGGGGTCCGGGAGG + Exonic