ID: 1132633141

View in Genome Browser
Species Human (GRCh38)
Location 16:929366-929388
Sequence CAGGGTCCACACTCAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132633122_1132633141 27 Left 1132633122 16:929316-929338 CCAGGTGCTAGGCATGGCGCCCC 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG 0: 1
1: 0
2: 2
3: 23
4: 249
1132633130_1132633141 8 Left 1132633130 16:929335-929357 CCCCATGGGGGACGGGGACCACG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG 0: 1
1: 0
2: 2
3: 23
4: 249
1132633132_1132633141 6 Left 1132633132 16:929337-929359 CCATGGGGGACGGGGACCACGCT 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG 0: 1
1: 0
2: 2
3: 23
4: 249
1132633137_1132633141 -10 Left 1132633137 16:929353-929375 CCACGCTGGAGGACAGGGTCCAC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG 0: 1
1: 0
2: 2
3: 23
4: 249
1132633131_1132633141 7 Left 1132633131 16:929336-929358 CCCATGGGGGACGGGGACCACGC 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG 0: 1
1: 0
2: 2
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132633141 Original CRISPR CAGGGTCCACACTCAGGGGA TGG Intronic
900333728 1:2150394-2150416 CAGTGCCCTCCCTCAGGGGAAGG - Intronic
901065141 1:6490754-6490776 CAGGATCCGGGCTCAGGGGAGGG + Intronic
902694290 1:18129819-18129841 CGGGCTCCACACTCATGGGTCGG + Intronic
902765673 1:18613217-18613239 CAGGGTTCACACTCCAGGCAGGG - Intergenic
902878106 1:19353072-19353094 CCGGGGCCACACACAGGGAAGGG + Intronic
907325582 1:53636849-53636871 AAGGGGCCACACTCAGTGCAGGG + Intronic
908087215 1:60648428-60648450 CACAGTCCACACTCAAGGGGTGG - Intergenic
908263361 1:62355681-62355703 CAAGGACCACACCCAGGGGATGG + Intergenic
910355858 1:86353814-86353836 CATTGCCCACACTGAGGGGACGG - Intronic
912417887 1:109522562-109522584 CAGGGCCCATAGTCTGGGGATGG - Intergenic
912464926 1:109865619-109865641 CAGGCCCCACACTTAGTGGAGGG - Intergenic
914322734 1:146580907-146580929 CAGGTTACAGACTCAGGGCAAGG + Intergenic
915355660 1:155254205-155254227 CAGGGTGCAGACTCAGGGCTGGG + Intronic
918472261 1:184886261-184886283 CAGCGCCCACACTCAGGGTAGGG + Intronic
920357576 1:205386127-205386149 CATAGTCCACACTCACTGGAGGG - Intronic
921098889 1:211911336-211911358 CAGGGTTCACACTGAATGGAGGG + Intergenic
922196145 1:223362734-223362756 CATGCTGCACACACAGGGGAAGG + Intronic
924263702 1:242258293-242258315 CAGTGACCATACTCAGTGGATGG - Intronic
1062836207 10:637503-637525 CTGGGTCCGCACACAGTGGAAGG + Intronic
1062918193 10:1258007-1258029 CAGGGTCCCCACTGTGTGGATGG - Intronic
1063086542 10:2823273-2823295 GAGGGTCCTCACTCACTGGATGG - Intergenic
1063403936 10:5774873-5774895 CTGGATTCACACCCAGGGGAAGG + Intronic
1066721097 10:38340177-38340199 CAGTGACCATACTCAGTGGATGG + Intergenic
1067278556 10:44854757-44854779 CAGGATCCACACTGGAGGGAGGG - Intergenic
1069760769 10:70809513-70809535 CTGTGTCAACACTCAGGAGAGGG + Intergenic
1069987640 10:72295418-72295440 GAGGGACCACACACAGAGGAAGG + Intergenic
1070721755 10:78761711-78761733 CAGGGCAGAGACTCAGGGGAAGG + Intergenic
1070814276 10:79313175-79313197 CAGGCTCCACAGTCACTGGAGGG - Exonic
1070943823 10:80371729-80371751 CAGAATCCACAGTGAGGGGAGGG + Intergenic
1071597827 10:86940879-86940901 CCGGGACCACACTCAGGGAGGGG + Intronic
1071882809 10:89917983-89918005 CAGTGCCCACACCGAGGGGATGG + Intergenic
1072320446 10:94244527-94244549 CAGGTTCCTGACTCAGCGGAGGG + Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1073840904 10:107497691-107497713 CAGGGTAGAAACTCAGGAGAGGG - Intergenic
1073907553 10:108300682-108300704 CAAGGTCCACTCTCAGGGTGTGG - Intergenic
1075438213 10:122460585-122460607 CTGGGTCCACACTGAGCAGATGG - Intergenic
1075842592 10:125517653-125517675 GGGTGTCCACACTCAGGGGAAGG + Intergenic
1077376853 11:2209291-2209313 CAGGGGCCCTACTCAGGAGATGG + Intergenic
1080034687 11:27699781-27699803 GAGGGTCCTGACTGAGGGGAGGG - Intronic
1080946073 11:36976890-36976912 CAGGGTCCACTCCCTGGGGCTGG - Intergenic
1084317435 11:68353714-68353736 CAGGGTCCTTCCTCAGAGGAGGG + Intronic
1084334762 11:68450203-68450225 CAGGGTCCCCAGTCCGTGGAAGG + Intergenic
1086296021 11:85369217-85369239 CAGCCTCCACACAGAGGGGAGGG - Intronic
1089194659 11:116687102-116687124 GAGAGGCCACACTGAGGGGAAGG + Intergenic
1089464395 11:118675328-118675350 CAGAATCCACACTCAGGTTAAGG + Intronic
1089747970 11:120630172-120630194 CAGGGTCCCCACACAGGGCAAGG - Intronic
1090285413 11:125495575-125495597 AAGGCTCCGCACTCTGGGGAGGG + Exonic
1091318379 11:134632215-134632237 CCGGCTCCACTCTCAGAGGATGG + Intergenic
1092090739 12:5801881-5801903 CAGGGTTTGCACTCAGGGGAGGG - Intronic
1093752100 12:22811571-22811593 AAGGGTCCACAATCCAGGGATGG - Intergenic
1096529478 12:52233986-52234008 CACGGTCCTCTCTCAGGGAAAGG - Intronic
1096874374 12:54615714-54615736 CAGAGTCCACAGTCAGAGGATGG + Intergenic
1098244834 12:68506395-68506417 TAGGGACCAAACTCATGGGAGGG - Intergenic
1098469533 12:70827474-70827496 CTGGGTCCTCACACAGTGGAGGG + Intronic
1102028198 12:109725440-109725462 CAGGGTGCAGACCTAGGGGAGGG - Intronic
1103517746 12:121518480-121518502 TGGGGTGCCCACTCAGGGGAAGG + Intronic
1104984508 12:132589074-132589096 CAGGCTCTACACGCTGGGGAAGG + Intergenic
1105422267 13:20263800-20263822 CATGGTTCACTCTCAGGGAAGGG - Intergenic
1106151278 13:27105252-27105274 CAGGAGCCACACTCCGGGGAAGG - Intronic
1106264791 13:28100399-28100421 CCGGGTCCACACTGCGGGGTGGG + Intronic
1106327756 13:28710344-28710366 CACAGTCCACCCTCAGGAGAAGG + Intronic
1106354911 13:28972207-28972229 CAGGGTCCACACCCTGGGTGGGG + Intronic
1106553618 13:30791775-30791797 CAGAGTCCACACTCAAGTGATGG - Intergenic
1111748568 13:92298280-92298302 CAGAATCCACAGTCAGGGGAAGG - Intronic
1117273996 14:54174052-54174074 CAGGCTCCAGACTCAGAAGAAGG + Intergenic
1119765901 14:77187499-77187521 CAGGCTCCACACTCCATGGAGGG + Intronic
1121259105 14:92553416-92553438 CTGGGACCACACTCAGGGCCTGG + Intronic
1123105992 14:105841315-105841337 CAGGCACCACACTCAGGGGGAGG - Intergenic
1123985846 15:25645203-25645225 CTGGGTCCTCACATAGGGGAAGG - Intergenic
1125633730 15:41169877-41169899 CTGTGTCCCCACTCAGGGGTTGG + Intergenic
1126063842 15:44810048-44810070 CTGAGTCCACACACAGGTGAAGG + Intergenic
1129391840 15:75224629-75224651 CAGGGACCACACTTTGGAGAGGG - Intergenic
1129602869 15:77010369-77010391 CAGGTTCCAGGTTCAGGGGAAGG - Intronic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1130034225 15:80342749-80342771 CTGGGTCCACACTTGAGGGATGG - Intergenic
1130120817 15:81046119-81046141 AAGGGTCCTTGCTCAGGGGAGGG - Intronic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG + Intronic
1132694057 16:1194348-1194370 CTGGGTCCACAGTCAGCTGACGG + Intronic
1132702222 16:1226752-1226774 CAGGGTTCCCACCGAGGGGACGG - Intergenic
1135805323 16:25537369-25537391 CAGGGAACTCACTCAGGGCATGG - Intergenic
1136090939 16:27919525-27919547 CTTGGTCCACACCCAGGAGAAGG + Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1136867477 16:33769130-33769152 CACTGTCCGCACTCTGGGGAGGG + Intergenic
1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG + Intronic
1138638840 16:58366123-58366145 CAGAGTACAGGCTCAGGGGATGG + Intronic
1139429632 16:66904231-66904253 CAGGGCCCACAAGCAGGGCAAGG + Intergenic
1140010830 16:71129943-71129965 CAGGTTACAGACTCAGGGCAAGG - Intronic
1140713603 16:77701679-77701701 CATGTCCCACACTCAAGGGAAGG - Intergenic
1141743859 16:85913112-85913134 AAGGCTGCACAGTCAGGGGAGGG - Exonic
1142116401 16:88358287-88358309 GAAGGTCCACACCCGGGGGAGGG + Intergenic
1142238702 16:88935361-88935383 CAGGGTCCCCACGCAGGTGGTGG - Intronic
1203104681 16_KI270728v1_random:1347073-1347095 CACTGTCCGCACTCTGGGGAGGG - Intergenic
1203128833 16_KI270728v1_random:1615295-1615317 CACTGTCCGCACTCTGGGGAGGG + Intergenic
1142685980 17:1577206-1577228 CAGGCCCCAGACTCTGGGGAGGG + Intronic
1142850759 17:2703706-2703728 CAGGCTGCACACACAGGGCATGG - Intronic
1142918539 17:3163750-3163772 CTGGATCCCCACTCTGGGGAAGG - Intergenic
1143715657 17:8766795-8766817 CAAGGGCCACTCTCAGGGAAAGG + Intergenic
1144686066 17:17227179-17227201 CAGGGCCCAAAATCAGGGGTGGG - Intronic
1144994591 17:19258758-19258780 CAGGGTTCCCACACAGGGAAAGG + Intronic
1145978170 17:28996324-28996346 CAGGGCCCACACCCTGGGGCAGG - Intronic
1146437236 17:32861598-32861620 CAGGGACCACACTTTGCGGAAGG - Intronic
1146894633 17:36532702-36532724 CAAGGACCACACACAGGTGAGGG + Intronic
1147164516 17:38586278-38586300 CAGGGCCCACGCTGGGGGGATGG - Intronic
1149596594 17:57868042-57868064 CGGGTTCCACTCCCAGGGGAGGG + Intronic
1151130792 17:71894301-71894323 CAGTGTCTACACCAAGGGGACGG + Intergenic
1151235225 17:72715080-72715102 CAGGGTCTGCACTCAGGAGGAGG + Intronic
1151307515 17:73272762-73272784 CAGTGTCCACAGTCAGCGGGCGG - Intergenic
1151448468 17:74182365-74182387 CAGGGTCCCCACCCCTGGGAAGG - Intergenic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1152342059 17:79730851-79730873 CACTGTCCCCACTCTGGGGAGGG + Intergenic
1152605304 17:81286605-81286627 GGGAGTCCACACTCGGGGGAGGG - Intronic
1152809014 17:82372330-82372352 CAGAGCCCTCACCCAGGGGACGG - Intergenic
1152830731 17:82495740-82495762 CAGGGTCCAGGCTCCTGGGAAGG - Intergenic
1154357833 18:13635785-13635807 CAGGGACCACCCTGAGGGGCTGG - Intronic
1156545398 18:37958878-37958900 AAAGGGCCACACTCAGAGGAAGG + Intergenic
1157583251 18:48785605-48785627 CAGAGACCAAACCCAGGGGAAGG + Intronic
1159072359 18:63640155-63640177 CGGGGTCCCCATTCAGAGGAAGG + Intronic
1160827861 19:1089074-1089096 CAAGGTGCCCACTCAGGGAAGGG + Intronic
1161234018 19:3189152-3189174 CAGAGTCCACTCCCAGGAGAGGG - Intronic
1161363258 19:3863399-3863421 CAATGTCCCCACTCCGGGGAGGG + Intronic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1163416115 19:17187426-17187448 CAGGAGCCACACACAGGTGATGG - Intronic
1165144786 19:33724268-33724290 CAGGCCCCACACCCAGGGCATGG - Intronic
1165555626 19:36629416-36629438 CAGGGTCCACAGTCATCTGAAGG - Intergenic
1166133579 19:40762105-40762127 CAGGCAGCACACTCAGGGGCTGG - Intronic
1166219958 19:41357855-41357877 CCGGGTCCAGGCTGAGGGGAGGG - Intronic
1166283276 19:41809147-41809169 CTAGGGCCACACTCAGGGGTGGG - Intronic
1166535401 19:43570992-43571014 CAGGGGCCACACACAGGAGTGGG - Intronic
1166764030 19:45241940-45241962 CAGGGCAGACACTCAGGGAATGG + Intronic
1168124171 19:54274647-54274669 CAGACTCCACACTCAGTAGAAGG - Exonic
925443269 2:3906553-3906575 CAGGGTCATCACTCAGAGAATGG - Intergenic
926060960 2:9804464-9804486 CTGTGTCCACACTTAGTGGAAGG - Intergenic
926553499 2:14329334-14329356 CTGGATCCACATTCAGGGTATGG + Intergenic
926697733 2:15782467-15782489 CAGGGACCCCCCTCAGGGGTGGG - Intergenic
927930141 2:27038610-27038632 CAGGGTCCCTTCTCAGGGAAGGG - Intronic
929592506 2:43156400-43156422 CACGGTCCACACCCAGGCTATGG + Intergenic
930018625 2:46987301-46987323 CAGGGTCCAGACTATGGGGGAGG + Intronic
932822724 2:74915266-74915288 CCGTGTCCACATTGAGGGGATGG + Intergenic
935600422 2:104916701-104916723 GTGGGTCCACACTCAAGGGGAGG + Intergenic
937854697 2:126663795-126663817 CCGGCTTCACACTCAGGGGAGGG - Intronic
938262489 2:129905694-129905716 CAGACTCCACCCTCAGCGGAGGG + Intergenic
938453036 2:131440793-131440815 CATGGTCCACGTTCAGGAGAGGG + Intergenic
940170935 2:150829522-150829544 CACAGTCTACACTCAAGGGAAGG + Intergenic
940656848 2:156497688-156497710 CAGGATCCACACTCAGGTTTTGG + Intronic
942375081 2:175328419-175328441 GAAGGTCCACGCTCAGGGTAAGG - Intergenic
943623929 2:190178884-190178906 TGGGTTCCACACTGAGGGGATGG - Intronic
943971816 2:194419377-194419399 CAGTGTCCTCACACAGTGGAAGG - Intergenic
944365188 2:198910912-198910934 CAGGCTCCCCACTCATGTGATGG - Intergenic
945946947 2:216003686-216003708 CAGGCTCCCCACTCAGATGATGG + Intronic
946309140 2:218873103-218873125 CAGGGTCCAAAGGCAGGGGGTGG - Intronic
947118705 2:226796761-226796783 TGGGGTCCACTCTCTGGGGATGG + Exonic
948570998 2:238917003-238917025 CTGGGTCCACACACCGGGGGTGG - Intergenic
948789443 2:240369816-240369838 CAGGGACCAGCCTCAGGGCATGG + Intergenic
1170620348 20:17990499-17990521 CAGGGTTCACCCAGAGGGGAAGG + Exonic
1170848366 20:19981442-19981464 CACTGCCCACACTCAAGGGATGG + Intronic
1171411226 20:24950044-24950066 GAGGGTCAGCACTCAGGGGGAGG + Intronic
1172232771 20:33348224-33348246 CAGGGTCCACACGTAGGTTAGGG + Intergenic
1173284382 20:41656925-41656947 CAGGGTCTACACACAGGGTGGGG + Intergenic
1173825204 20:46043750-46043772 CTGGGACCACCCTCGGGGGAGGG + Intronic
1174609114 20:51784528-51784550 CAGGGTCCACATTCACTGAAGGG + Exonic
1179116045 21:38493739-38493761 CAGGTACCACACACAGGGGCAGG - Intronic
1179680614 21:43018597-43018619 CAGGGTCCCCACAAAGGGCACGG + Intronic
1179681184 21:43022327-43022349 AGGGGCCCACAGTCAGGGGAGGG - Intronic
1179881905 21:44296508-44296530 CAGGCTCCCCACTCTGGGGGAGG + Intronic
1180135733 21:45860795-45860817 CCAGGGCCACGCTCAGGGGAGGG - Intronic
1180214624 21:46316487-46316509 GAGGGTCTACACTCAAGAGAAGG + Intronic
1181052912 22:20246162-20246184 CAGGAGCCACAGTCAGGGGAGGG + Intronic
1181181202 22:21069815-21069837 CAGGGACCACCGTCAGGGGCTGG - Intergenic
1181989075 22:26822812-26822834 CAGGGTGCACACACAGGGTTGGG + Intergenic
1182486212 22:30640655-30640677 CAGGGTGCCCACTCAGGGTGGGG + Intronic
1183742152 22:39674701-39674723 CAGAGGCCACCCTGAGGGGAGGG - Intronic
1183947979 22:41337681-41337703 CAGGGTCCTCACCCCGGTGAAGG - Intronic
1184045694 22:41971138-41971160 CAGGGGCCACACTCAGGCCCAGG + Intergenic
1184095290 22:42313050-42313072 CAGGGTCCACAGTATGGTGATGG - Intronic
1184262818 22:43329130-43329152 CAGGGTCCAGGCTAAGGGCAAGG - Intronic
1184509010 22:44921199-44921221 CAGGGTGGACATTCAGGGTAAGG + Intronic
1184863708 22:47191169-47191191 CAGCGTCCTCACTCATGGGCAGG - Intergenic
950408149 3:12817233-12817255 CATAGTCCACACACGGGGGACGG - Exonic
951806754 3:26653002-26653024 CTGGGTCAACAAGCAGGGGATGG + Intronic
953548736 3:43884169-43884191 CAGGGTTCACACTCAAGGACAGG - Intergenic
954124147 3:48518858-48518880 CAGTGTCCACAGCCAGGGAAGGG + Exonic
954533972 3:51344154-51344176 CATGGTCCACACTCATTTGAAGG + Intronic
956167148 3:66405522-66405544 CGGAGGCCACACTCAAGGGAAGG + Intronic
956453034 3:69392757-69392779 CAGGCTCCTCACTCAGGGGGTGG + Intronic
956705483 3:71995454-71995476 GAGGGGCCCCACTCTGGGGAAGG + Intergenic
961449158 3:126994748-126994770 CAGGGTCCAGAGCCAGGGTAAGG + Intronic
961676431 3:128569851-128569873 CAGGGTCCATAATCTGGGGAGGG + Intergenic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962702208 3:138010523-138010545 CAGGGTCCTCACCCAGAGGTGGG - Intronic
964569148 3:158094236-158094258 CAGTGTCCAAACTCTGGGGCAGG - Intergenic
968004015 3:195226965-195226987 CAGGGTCCACAAGCAGGGGATGG + Intronic
968737092 4:2303302-2303324 GAGGGTCCTCACACTGGGGAAGG - Intronic
968921191 4:3522960-3522982 CAGGGACCACACCCAGAAGATGG + Intronic
969173001 4:5379018-5379040 CAGGGTCAACACTAAGGTCAGGG + Intronic
969232182 4:5839556-5839578 TAGGGTCCGGGCTCAGGGGAGGG + Exonic
969381517 4:6802129-6802151 TAGGGTCCAGACTCAGGGAATGG + Intronic
969444201 4:7234868-7234890 CAGGGGACAGACTCAGGGGCAGG + Intronic
969494075 4:7515925-7515947 CTGTGTCCTCACTCATGGGAGGG + Intronic
969857912 4:10014801-10014823 CAAGGTCAACACCCAGGGAAGGG + Intronic
969862341 4:10047479-10047501 CAAGGCCCACTCACAGGGGAAGG - Intronic
969973685 4:11074663-11074685 CAGGTACCACACTCTGGGTACGG - Intergenic
973588423 4:52415135-52415157 CACAGTCCACACTCAAGGAATGG - Intergenic
974305509 4:60133502-60133524 CAGGGCACACAGTCATGGGATGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976805948 4:89047061-89047083 CAGGCTCCGAACACAGGGGAAGG + Intronic
982071915 4:151702996-151703018 CGGACTCCACACTCAGGGGAAGG + Intronic
985857351 5:2440261-2440283 AAGGGGCCAAACTCGGGGGATGG + Intergenic
987093680 5:14529640-14529662 CAGGGACCACATTCTGGGCAGGG - Intronic
992491697 5:77250648-77250670 CAGGGTCCACAATCAGGGTGAGG + Intronic
994840001 5:104911131-104911153 CTGGGTCTACCCTCAGGGCAAGG - Intergenic
996422691 5:123279479-123279501 CAGGGACCTGACTGAGGGGATGG - Intergenic
997369704 5:133350736-133350758 CCAGGGCCACACCCAGGGGATGG - Intronic
997821577 5:137070750-137070772 CAGGGCCCACAGTCATGGCAAGG - Intronic
999801604 5:155043522-155043544 CAAAGTCCACACTCAAGGGAAGG + Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1000328404 5:160188858-160188880 CAGGGGCCACCCCAAGGGGATGG - Intronic
1000338672 5:160260598-160260620 GAGGGTCAAGACTCAGGGGCTGG + Intronic
1000978120 5:167787141-167787163 GAGATTCCACACTCAGGAGATGG + Intronic
1002640974 5:180630476-180630498 CAGGGTCCACAGGCTGGGGGCGG + Intronic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1014683822 6:124469803-124469825 CAGGGTCCACAACTAAGGGATGG - Intronic
1017344564 6:153366189-153366211 CAGGGTCCTGACTCAGGAGAAGG + Intergenic
1018092648 6:160358496-160358518 CAGGGTCCACTCTCTGGAGCTGG + Intronic
1018151125 6:160940453-160940475 CAGGATCCACATTCAGGACAGGG + Intergenic
1022384524 7:29888973-29888995 CAGGGTCCAGAATCAGAGGTGGG - Intronic
1022533758 7:31083196-31083218 CGGGGGCCACACTCAGGTGCTGG + Intronic
1024546718 7:50528643-50528665 AAGGCTCCACAGTCAGGGGCAGG - Intronic
1024917280 7:54515495-54515517 CAGACTCCACAGGCAGGGGAAGG - Intergenic
1025012835 7:55412112-55412134 CTGGCTCCCCACACAGGGGACGG - Intronic
1026844998 7:73693774-73693796 CAGGGTCTGCACTCTGGGGCTGG - Intronic
1026853353 7:73738198-73738220 CAGGGTCCATACTCAGAGTGAGG + Intronic
1029728952 7:102426784-102426806 CAGGTTGCAGACTCAGGGCAGGG - Intergenic
1031979806 7:128117157-128117179 CAGATTACACACTCTGGGGATGG - Intergenic
1032675212 7:134123925-134123947 CAAGGTCCACACTCCTGGAAAGG + Intergenic
1033044183 7:137946167-137946189 CACAGGCCACACTCAAGGGAAGG - Intronic
1034072181 7:148196893-148196915 CAGGGTCCAGGCTCAAGGGAGGG + Intronic
1034331806 7:150289324-150289346 CAAGCCCCACACTCATGGGAAGG + Intronic
1034548077 7:151802055-151802077 CAGAGGCCACACTCAGGGAGGGG - Intronic
1035169798 7:157010911-157010933 CCGGCTCCGCACCCAGGGGAGGG - Intergenic
1035355050 7:158271496-158271518 CAGAGTCCACATGCACGGGACGG + Intronic
1035454202 7:158998112-158998134 GGGGGTCCACACTGAGGAGAGGG - Intergenic
1035454361 7:158998573-158998595 GGGGGTCCACACTGAGGAGAGGG - Intergenic
1035454394 7:158998674-158998696 GGGGGTCCACACTTAGGAGAGGG - Intergenic
1035454447 7:158998830-158998852 GGGGGTCCACACTGAGGAGAGGG - Intergenic
1035658172 8:1327098-1327120 CAGGCTCCGCTCTCAGGAGACGG - Intergenic
1035783598 8:2247183-2247205 CAGTGTCCACGATCAGGGGAAGG + Intergenic
1035808527 8:2472403-2472425 CAGTGTCCACGATCAGGGGAAGG - Intergenic
1036616279 8:10390205-10390227 CAGGGTCTGCTCTGAGGGGATGG + Intronic
1040416590 8:47201166-47201188 CAGGAGACAGACTCAGGGGAGGG + Intergenic
1042217348 8:66439433-66439455 GAGGGACCACAGCCAGGGGAGGG + Intronic
1043381709 8:79709491-79709513 CACTGTACACACACAGGGGAAGG - Intergenic
1046791427 8:118326357-118326379 CAGGGTCCCAAGTTAGGGGAAGG + Intronic
1048012458 8:130469165-130469187 CTGAGTCCACACTCAGGTGTAGG - Intergenic
1048817459 8:138347176-138347198 CTGGCTCCTCACTCAGGGAATGG + Intronic
1049389727 8:142361500-142361522 CAGGGCCCACACCCAGACGAGGG + Intronic
1049843193 8:144787200-144787222 CAGGGGCAACGCGCAGGGGAGGG + Intronic
1051265409 9:15304790-15304812 CAAGGTCAACAGTCATGGGAAGG + Intronic
1052016510 9:23474609-23474631 TATGGTCCACATTCAGGGCATGG - Intergenic
1052316764 9:27123406-27123428 AAGGGACCACATGCAGGGGAAGG - Intronic
1052622370 9:30930199-30930221 CTGTGTCCCCACTTAGGGGAGGG + Intergenic
1053917498 9:42954339-42954361 CAGGGACCCCACTCAGGGTGGGG - Intergenic
1056592001 9:87971408-87971430 CAGGGTCCTCTGTCAGGGCATGG - Intronic
1059597890 9:115743096-115743118 CAGGATCCAAACTCAGGTGCAGG + Intergenic
1062181167 9:135192016-135192038 CAGGCCCCACACACAGAGGATGG + Intergenic
1062303239 9:135887627-135887649 CAGGGTACAGACGCAGGGAAGGG + Intronic
1185698805 X:2214940-2214962 CAGGGTCCCCACGCACGGAAGGG - Intergenic
1188812893 X:34673605-34673627 CAGGGTGTACCCTCAGGAGAGGG + Intergenic
1189898507 X:45681723-45681745 CAGGATCCAAACTCAGGGGATGG - Intergenic
1192148495 X:68697568-68697590 CAGGGGCCAGGCGCAGGGGAGGG - Intronic
1193693653 X:84680241-84680263 CTGAGTCCACTCTCTGGGGAGGG + Intergenic
1199730545 X:150628060-150628082 CAAGTGCTACACTCAGGGGAAGG - Intronic
1201560329 Y:15309489-15309511 GAAGATCCACTCTCAGGGGAAGG + Intergenic