ID: 1132633390

View in Genome Browser
Species Human (GRCh38)
Location 16:930622-930644
Sequence CGGGGGCTGTGCGGACTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132633384_1132633390 3 Left 1132633384 16:930596-930618 CCTGAGAAAAAGGAAGACACTAG 0: 1
1: 0
2: 1
3: 40
4: 338
Right 1132633390 16:930622-930644 CGGGGGCTGTGCGGACTTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132633390 Original CRISPR CGGGGGCTGTGCGGACTTCC CGG Intronic
900110138 1:1001807-1001829 CGGGGGCTGGGCGGGCGTCTCGG + Intergenic
900369821 1:2326704-2326726 CCGGGGTGGTGCGGACTTACTGG - Intronic
900578153 1:3394355-3394377 CGGGGGCTGGGCGGCCCTCCTGG - Intronic
901408933 1:9069435-9069457 CAGGGCCTGTGCAGCCTTCCTGG - Intronic
904211146 1:28887543-28887565 CGGGGGCTGCGCCGACCTGCAGG - Intronic
905174108 1:36125438-36125460 CAGGGGCTGCGCGGACTCCCCGG - Intergenic
905517900 1:38575781-38575803 CGGGGGGTGGGGGGTCTTCCTGG - Intergenic
907501821 1:54886776-54886798 CGGGGGCGGCCAGGACTTCCTGG - Intronic
915366314 1:155318694-155318716 GGGGGGCTGTGAGGAGGTCCAGG - Exonic
917224553 1:172767604-172767626 CTGGGGATGAGCTGACTTCCAGG + Intergenic
918968491 1:191381571-191381593 CAGGGGGTGGGGGGACTTCCAGG - Intergenic
1066272747 10:33839436-33839458 CAGAGACTGTGAGGACTTCCTGG - Intergenic
1066414395 10:35206975-35206997 TGGGGACTGTGCAAACTTCCGGG - Exonic
1070075658 10:73132507-73132529 AGGGGAGTGTGCGGAATTCCTGG + Intronic
1072914602 10:99530308-99530330 CAGGGCCTGTGAGGACTTCCAGG - Intergenic
1072954145 10:99874101-99874123 CTGGGGCTGTGAGGACCTGCTGG + Intergenic
1076707106 10:132308020-132308042 CGGGGGCGGGGCGGAGCTCCTGG + Intronic
1077111584 11:864386-864408 CGGAGGCTGTGCGGCCTTTCGGG + Intronic
1084220545 11:67674939-67674961 TGGGGCCTGGGAGGACTTCCTGG - Intronic
1085533194 11:77203562-77203584 AGGGGGCAGAGAGGACTTCCTGG + Intronic
1085895758 11:80637673-80637695 CGGGAGCTCTGCTGACATCCAGG - Intergenic
1090333765 11:125949783-125949805 CCTGGGCTGTGGGCACTTCCTGG - Intergenic
1091730557 12:2877233-2877255 CGAAGGCTGTGCGGTCTGCCAGG + Exonic
1099958102 12:89370889-89370911 TGGGGGCTGTGCCCACTTTCAGG - Intergenic
1100518282 12:95349496-95349518 CAGGGGCTGCCCGGACTTTCTGG - Intergenic
1101679156 12:106947888-106947910 TGGGGGGTGAGAGGACTTCCAGG + Intergenic
1101878338 12:108609878-108609900 CGGGGGCTGTGGGGACATGGAGG + Intergenic
1102421213 12:112804341-112804363 GTGGGGCTGTGAGCACTTCCAGG + Intronic
1103602754 12:122064483-122064505 CGGGGGTTGTGCTGGCTTCAGGG - Intergenic
1103899722 12:124296951-124296973 AAGGGGCAGTGAGGACTTCCAGG + Intronic
1105821769 13:24086758-24086780 CGGGTGCAGAGCGGAATTCCAGG + Intronic
1106242816 13:27924203-27924225 TGGGGGCTGTGCGGGGCTCCGGG + Intronic
1109178274 13:59181965-59181987 TTGGGGCTTTGCGGACTTCATGG - Intergenic
1115202516 14:30869990-30870012 TGGGGGCTGTGCTGTCTTCCAGG - Intergenic
1122235625 14:100329387-100329409 CGGGGGCTGTGCAGGAGTCCTGG + Exonic
1123009069 14:105338523-105338545 TGGGGGCTGTGCAGGATTCCGGG + Intronic
1125541366 15:40471553-40471575 CGGGCGGTGTGCGGACAGCCAGG + Exonic
1127880930 15:63157779-63157801 CGGGGGCTGAGCGGCCCGCCGGG - Exonic
1129732455 15:77939978-77940000 AGGGGGCTGTGCAGCCTTGCGGG - Intergenic
1129825824 15:78634481-78634503 CTGGGGCTGTGCGTCCTCCCAGG + Intronic
1131830600 15:96352440-96352462 CACGAGCTGTGCGGACTTCCAGG - Intergenic
1132511834 16:346680-346702 GGAGGGCTGTGCCGACTTGCTGG - Exonic
1132536477 16:483886-483908 CGGGGGACGGGCGGGCTTCCAGG - Intronic
1132633390 16:930622-930644 CGGGGGCTGTGCGGACTTCCCGG + Intronic
1132714365 16:1283503-1283525 CTGGGGCTGAGCCGGCTTCCTGG - Intergenic
1133774842 16:8888186-8888208 CGGGGGCTGCTCGGTCTTGCTGG + Intergenic
1133859365 16:9579783-9579805 CAAGGGTTGTGCAGACTTCCAGG + Intergenic
1138029673 16:53550509-53550531 CTGGGGCTCTCCAGACTTCCTGG + Intergenic
1139314806 16:66059138-66059160 AGGGGGCTGTGTGGAAATCCAGG - Intergenic
1140969292 16:79997466-79997488 TGGTGGCTCTGAGGACTTCCTGG - Intergenic
1141689662 16:85589037-85589059 CATGGGCTGTGCTGACTTCCAGG + Intergenic
1141977831 16:87529287-87529309 CATGGGGTGTGGGGACTTCCGGG + Intergenic
1142240250 16:88941554-88941576 CCGGGGCTGTGCGGAGCGCCGGG + Intronic
1143109998 17:4547861-4547883 TGAGGGCTGTGCGGGTTTCCAGG - Intronic
1150210183 17:63437601-63437623 CGGGGGCTGTGCGCATCTCGGGG - Intronic
1152150268 17:78595297-78595319 TGGGGGTTGGGGGGACTTCCAGG - Intergenic
1155942638 18:31815243-31815265 CAGCGGCTGTGCTGGCTTCCAGG - Intergenic
1160385921 18:78496216-78496238 CTGGGGCGGAGCCGACTTCCAGG + Intergenic
1160499432 18:79394831-79394853 CTGGGGGTCTGCGGACCTCCTGG + Intergenic
1160809682 19:1008001-1008023 CGGGGTCTCTGGGGACCTCCTGG + Intronic
1160947401 19:1650149-1650171 CGGGGGCTGGGCGGGGGTCCTGG + Intronic
1161041109 19:2111193-2111215 CGGGAGCTGTGGGGGCTGCCCGG + Intronic
1162733822 19:12734686-12734708 CGGGGCCGGAGCGGCCTTCCCGG - Exonic
1163607284 19:18282012-18282034 CGGGGGCGGTGCCGGCCTCCGGG + Intergenic
1168143681 19:54406796-54406818 AGGGGGCTGGGGGAACTTCCTGG - Intergenic
925000103 2:398432-398454 CGTGGGCTGTGCAGACAGCCAGG + Intergenic
927152505 2:20204044-20204066 CGGGAGCTGTGTGGTCTCCCTGG + Exonic
929075732 2:38077268-38077290 CGGCGGCTCTGTGGTCTTCCTGG + Intronic
933097377 2:78203657-78203679 GGGTGGCTGTGCGGAGCTCCTGG - Intergenic
934699093 2:96424090-96424112 CGTGGGCTGTGAGGACATTCAGG + Intergenic
936049438 2:109212038-109212060 GGTGGGCTTTGCGGAATTCCAGG + Intronic
937951915 2:127394706-127394728 CGGGGGCTGGGCACACTGCCTGG + Intergenic
942324541 2:174764907-174764929 CGGGGGCTTTTCTGACTGCCTGG + Intergenic
946017745 2:216617592-216617614 TGTGGGCTGGGAGGACTTCCTGG - Intergenic
947736134 2:232456489-232456511 CCGGGGCTGTGAGGACTACGGGG - Intronic
948880795 2:240856259-240856281 AGGAGGCTGTGCCGACTCCCAGG + Intergenic
1168790507 20:572864-572886 AGAGGGCTGTGGGGACTTCTGGG + Intergenic
1172916511 20:38447470-38447492 CGTGGGCTGTGCGGCTATCCTGG + Intergenic
1174272790 20:49381699-49381721 CTGGGGCTGGGAGGACTCCCAGG - Intronic
1175561324 20:59933348-59933370 CGTGGGCTGTGCAGAGTTCGCGG - Intronic
1175869106 20:62199135-62199157 CCGGAGCAGTGAGGACTTCCCGG - Exonic
1179801358 21:43812929-43812951 AGGGGGCTGTGGGCACCTCCAGG - Intergenic
1180261232 21:46670529-46670551 TGGGGGCTGAGCAGAGTTCCTGG + Intergenic
1183932017 22:41240753-41240775 CAGGGGCTCTGGGGACTTCCTGG - Intronic
1185342802 22:50299239-50299261 CTAGGGCTGTGCGGCCCTCCAGG + Intronic
1185362901 22:50419763-50419785 CGGGAGCTGTGGGGACTTGTCGG - Intronic
952593553 3:34988198-34988220 CGAGGGCTGTGAGGACTGCCAGG - Intergenic
954369546 3:50163005-50163027 CGGGGGCTGAGCGGCTTCCCAGG + Intronic
954868900 3:53751939-53751961 ACGGGGCTGTGCGGAATGCCCGG - Intronic
954880878 3:53835385-53835407 CTGGGGCAGTGCTGACTTCAGGG - Intronic
955415454 3:58687186-58687208 TGGGGGCTGGGAGGACTTCCTGG - Intergenic
959732451 3:109619325-109619347 CCTGGGCTGTGGGGATTTCCAGG + Intergenic
960953272 3:123013306-123013328 CGGGTGTTGTGAGGATTTCCTGG - Intronic
962248538 3:133819712-133819734 CGTGGGCTCTGCTGACATCCAGG + Exonic
964139309 3:153378863-153378885 CGAGGGCTCTGAGGACTGCCAGG + Intergenic
964570606 3:158105174-158105196 CAGGGGCTCTGCGGAGTTCGAGG + Intronic
964999517 3:162935448-162935470 AGTGGGATGTGTGGACTTCCAGG - Intergenic
968433792 4:575108-575130 CGGGGACTGCGCGGGCTTCGCGG - Intergenic
981315341 4:143336015-143336037 CGAGGCCTCTGCGGTCTTCCCGG + Intergenic
983881205 4:172935194-172935216 GGGTGGCTGTGTGCACTTCCAGG - Intronic
985710345 5:1424298-1424320 CTGGGGCAGTGGGGACTCCCAGG + Intronic
985988306 5:3535722-3535744 CGTGGGCTGAGTGGACTTCTAGG + Intergenic
988494863 5:31736275-31736297 CGAGCCCTGTGCAGACTTCCAGG - Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
997700448 5:135894578-135894600 CAGGGGCTGTGCTGTCTGCCTGG + Intronic
998380060 5:141717883-141717905 CAGGGGCTGTTGGGACTTGCAGG + Intergenic
999281395 5:150368807-150368829 TGAGGGCTCTGCTGACTTCCTGG - Exonic
1004216849 6:13711488-13711510 CGGCGGCTGCCCGGACATCCCGG + Exonic
1006380906 6:33696598-33696620 CGGGGGCTGTGGGGATTAACAGG + Intronic
1010032963 6:71289076-71289098 CGGGGGCTGCGCGGGCTGCTCGG - Exonic
1013419160 6:109950483-109950505 CTGGGGGTGGGGGGACTTCCAGG + Intergenic
1015181416 6:130365940-130365962 GGGGGCCGGGGCGGACTTCCAGG - Intronic
1017137408 6:151160540-151160562 GGGGCGCTGTGCAGACCTCCAGG + Intergenic
1017774444 6:157669843-157669865 TGGAGGCTGTGCGGAGTTACAGG + Intronic
1018400649 6:163415659-163415681 CGGGGGCTGCGCGGACTCGGTGG + Intronic
1018414556 6:163590142-163590164 CGGGGGCAAGGCTGACTTCCAGG - Intergenic
1018613565 6:165664072-165664094 CACGGGCTGTCCGGACTGCCTGG + Intronic
1019388884 7:774234-774256 CGGGGACTGCGCAGGCTTCCTGG + Intronic
1019598304 7:1868639-1868661 CATGGGCTGTGCTGACTTCCAGG - Intronic
1024227097 7:47334084-47334106 TTGGTGCTGTGCGGACTTCCTGG - Intronic
1027270554 7:76516292-76516314 CTGCGGCTGTGCGGACTGCATGG - Intronic
1030820700 7:114087536-114087558 CGGGGCCACTGTGGACTTCCAGG - Intronic
1031887289 7:127254903-127254925 ATGGGGCTGGGTGGACTTCCTGG + Intergenic
1034268400 7:149791939-149791961 CGGGTGCTGTGCAGGCCTCCGGG - Intergenic
1034498994 7:151438172-151438194 CGGGGACTGTGACAACTTCCAGG - Exonic
1035447329 7:158951866-158951888 CGGGGGACGTGAGGGCTTCCAGG + Intronic
1036808118 8:11848956-11848978 AGGGGACTTTGAGGACTTCCTGG - Intronic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1042876971 8:73448962-73448984 CTGGGGCTGGGAAGACTTCCTGG + Intronic
1046621137 8:116530923-116530945 CGAGGGCTGTGAGGACTGCCAGG - Intergenic
1047858267 8:128936496-128936518 CAGGGGCTGTGAAGACTTTCTGG + Intergenic
1049367623 8:142248350-142248372 GGGGAGCTGTGCGGGCATCCTGG - Intronic
1049403490 8:142441339-142441361 CAGAGGCTGTGTGGACTTCAGGG - Intergenic
1054274222 9:63052611-63052633 CTGGGGCTGTGCTGCCTGCCCGG - Intergenic
1054400619 9:64712358-64712380 CTGGGGCTGTGCTGCCTGCCCGG + Intergenic
1054434225 9:65196673-65196695 CTGGGGCTGTGCTGCCTGCCCGG + Intergenic
1054496163 9:65825007-65825029 CTGGGGCTGTGCTGCCTGCCGGG - Intergenic
1056163632 9:83921588-83921610 CCGGCCCTTTGCGGACTTCCTGG - Intergenic
1060583368 9:124771056-124771078 CGGGGGCTCGGCGGGGTTCCTGG - Exonic
1061246692 9:129404387-129404409 CTAGGGCTGTGCCCACTTCCAGG - Intergenic
1061329754 9:129885165-129885187 CAGGGGCTGTGCGGACTGAAGGG + Intergenic
1061483653 9:130909305-130909327 CCGGGTGTGTGCGGACATCCAGG - Intronic
1062182504 9:135198206-135198228 CGGGGGCTGAGAAGGCTTCCTGG - Intergenic
1189418242 X:40833145-40833167 CGGCGGCCGTGCGGCCTCCCAGG - Intergenic
1200065246 X:153501698-153501720 CGGGGGCCGGGCAGGCTTCCCGG - Intronic