ID: 1132634005

View in Genome Browser
Species Human (GRCh38)
Location 16:934020-934042
Sequence CCCGGGCACCTAGAGACGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132634005_1132634022 20 Left 1132634005 16:934020-934042 CCATCCGTCTCTAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132634022 16:934063-934085 CCACATCCAGGGAGGAGGCACGG 0: 1
1: 0
2: 6
3: 53
4: 491
1132634005_1132634018 12 Left 1132634005 16:934020-934042 CCATCCGTCTCTAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132634018 16:934055-934077 AGGAGCTCCCACATCCAGGGAGG 0: 1
1: 0
2: 4
3: 27
4: 192
1132634005_1132634016 9 Left 1132634005 16:934020-934042 CCATCCGTCTCTAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132634016 16:934052-934074 CCCAGGAGCTCCCACATCCAGGG 0: 1
1: 0
2: 2
3: 46
4: 497
1132634005_1132634010 -8 Left 1132634005 16:934020-934042 CCATCCGTCTCTAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132634010 16:934035-934057 TGCCCGGGGCCTGGAAGCCCAGG 0: 1
1: 1
2: 4
3: 30
4: 364
1132634005_1132634019 15 Left 1132634005 16:934020-934042 CCATCCGTCTCTAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132634019 16:934058-934080 AGCTCCCACATCCAGGGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 267
1132634005_1132634014 8 Left 1132634005 16:934020-934042 CCATCCGTCTCTAGGTGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132634014 16:934051-934073 GCCCAGGAGCTCCCACATCCAGG 0: 1
1: 0
2: 2
3: 26
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132634005 Original CRISPR CCCGGGCACCTAGAGACGGA TGG (reversed) Intronic
900313646 1:2046703-2046725 CCCAGGCACCGGGAGAGGGAAGG + Intergenic
901551279 1:9997621-9997643 CGCGGGCACTCAGGGACGGACGG - Intronic
902383028 1:16061499-16061521 CCTGGGCACCTAGAGAGGCCGGG + Intronic
916063414 1:161117825-161117847 GCGTGGCACCTAGAGAGGGAAGG - Intronic
917671001 1:177273474-177273496 CTCGGTGACCTAGAGAAGGAAGG - Exonic
1067778090 10:49177300-49177322 CCCTGGGAACTAGAGAGGGAGGG - Intronic
1075025895 10:118982784-118982806 CCAGGGCACCTGGAGACCCAGGG - Intergenic
1076299044 10:129410822-129410844 TCCTGGCACCTAGGGACTGACGG - Intergenic
1084576089 11:69988885-69988907 CCTGGGCACCAAGTGAAGGAGGG + Intergenic
1092282425 12:7108366-7108388 CCCGGGTACCCAGAGCCGTATGG - Exonic
1103940105 12:124496730-124496752 CCCTGGCACCTGGGGAGGGAGGG - Intronic
1132634005 16:934020-934042 CCCGGGCACCTAGAGACGGATGG - Intronic
1134102253 16:11460663-11460685 CCAGGGCTCCAAGAGAAGGAGGG + Intronic
1139655373 16:68384084-68384106 CCCAGGCACCTAGGCAGGGAAGG + Intronic
1142304166 16:89276216-89276238 GCCGGGCACCTGCAGGCGGAAGG + Intronic
1149378310 17:56067879-56067901 CCTGGGCATCTAGAGATGCAAGG + Intergenic
1151522329 17:74639272-74639294 TCTGGGCACCAAGAGACAGAGGG - Intergenic
1152625078 17:81384314-81384336 CCCGGGCACCTAGGGGAGGCTGG + Intergenic
1154253741 18:12765679-12765701 CCCAGGCTCCTAGAGGCTGAGGG + Intergenic
1156245145 18:35290508-35290530 CCCGGGCACGGAGAGACGATTGG + Intergenic
1160823940 19:1070894-1070916 ACCTGACACCTAGAGAGGGAAGG - Intronic
1162312253 19:9914191-9914213 CCCGGCCACCCAAAGACGGCAGG + Intronic
1163385686 19:16998612-16998634 TCCGGGCACCTACAAAGGGATGG + Intronic
1164402083 19:27909637-27909659 CTCGGGCACCTGCAGAGGGAGGG + Intergenic
1164755407 19:30685510-30685532 CCCAGGGAGGTAGAGACGGAAGG + Intronic
1166726109 19:45028776-45028798 CCCGGGGCCCTGGAGACGTAGGG - Intronic
1168078033 19:53991354-53991376 CCCGGGCAGCAGGAGACGGGCGG - Intergenic
926311270 2:11677778-11677800 CGCGGGCACCTGGGGATGGAAGG - Intronic
927645978 2:24877201-24877223 CCTGGGCACCTAGGGCTGGATGG - Intronic
928770331 2:34697011-34697033 CACGGGAACCTAGAGTGGGAGGG + Intergenic
929074301 2:38065621-38065643 CACGGGCTCTGAGAGACGGAAGG + Intronic
931252861 2:60549624-60549646 CCCGGGGGCCCGGAGACGGAGGG + Intronic
945987879 2:216370005-216370027 CCCCGGCGCCCAGAGCCGGAAGG + Exonic
946921876 2:224588654-224588676 CCCGAGTACCTAGAAACTGATGG - Intergenic
948272668 2:236686483-236686505 CCCGGGCACATGGAGAAAGATGG - Intergenic
948373471 2:237505249-237505271 GCCGGGCACTGAGATACGGATGG + Intronic
1182442957 22:30374766-30374788 CCCGGGCTCCTGGAGCCAGAAGG + Exonic
950684697 3:14608172-14608194 CCCAGGCACCTAGAGCTGGAAGG + Intergenic
954085433 3:48240443-48240465 CCTGGGCTCCTAGAGCAGGATGG - Intergenic
954401694 3:50322573-50322595 CCCGGGCGCCAGGAGAGGGAGGG + Exonic
954628214 3:52034498-52034520 CCCGAGGGCCTAGAGAGGGAGGG + Intergenic
956084893 3:65598165-65598187 CCCGGGCTCCTAGAGGCTGCCGG + Intronic
961567802 3:127776090-127776112 CACGGGCAGCCAGAAACGGAGGG - Intronic
966849318 3:184155209-184155231 CCCGGGTCCCTAGAAACGGAAGG - Intronic
969413609 4:7044711-7044733 CCCGGGCACCCTGAGGAGGAGGG + Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
985584330 5:721513-721535 CCCGGGCCCCGAGATATGGAGGG + Intronic
986470542 5:8069656-8069678 CATGGGCACCTAGAGATAGAGGG - Intergenic
1002418148 5:179131607-179131629 CCCAGGCACCTTCAGAGGGAGGG + Intronic
1016329784 6:142944797-142944819 CCCGGGCGCGTGGAGACGGGTGG - Intronic
1019304346 7:325756-325778 CCCAAGCACACAGAGACGGATGG - Intergenic
1029667846 7:102007443-102007465 CCCTGGCACCCAGGGGCGGAGGG - Intronic
1032364062 7:131282999-131283021 CACGGGCACCTAGTAAGGGAGGG + Intronic
1033290935 7:140082167-140082189 CCAGGGCACCCAGAAACGGAAGG + Intergenic
1048117818 8:131545099-131545121 CCCAAGCACCTTGAGAAGGAGGG + Intergenic
1049317780 8:141978451-141978473 CCTGGGCACTTAGAGCTGGAAGG + Intergenic
1056833197 9:89933109-89933131 CAAGGGCACCAAGAGACGGGTGG + Intergenic
1057546183 9:96021650-96021672 CCCAGGCACCTGGAGCCGGGAGG + Intergenic
1061046300 9:128166934-128166956 CATGGGCCCCTAGAGAGGGAGGG - Intronic
1062137147 9:134935207-134935229 GCCGGGCACCTGAAGACGGATGG + Intergenic