ID: 1132637430

View in Genome Browser
Species Human (GRCh38)
Location 16:958970-958992
Sequence CAGCATCCCCGGCACAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132637430_1132637439 7 Left 1132637430 16:958970-958992 CCCTCGCTGTGCCGGGGATGCTG 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1132637439 16:959000-959022 CCACTGTGGATGGCAGACGGTGG 0: 1
1: 0
2: 0
3: 17
4: 238
1132637430_1132637434 -7 Left 1132637430 16:958970-958992 CCCTCGCTGTGCCGGGGATGCTG 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1132637434 16:958986-959008 GATGCTGTGGCCTACCACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 123
1132637430_1132637435 -3 Left 1132637430 16:958970-958992 CCCTCGCTGTGCCGGGGATGCTG 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1132637435 16:958990-959012 CTGTGGCCTACCACTGTGGATGG 0: 1
1: 0
2: 1
3: 33
4: 332
1132637430_1132637440 29 Left 1132637430 16:958970-958992 CCCTCGCTGTGCCGGGGATGCTG 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1132637440 16:959022-959044 GCATCTGACCCAGATAATGAAGG 0: 1
1: 0
2: 0
3: 19
4: 120
1132637430_1132637437 4 Left 1132637430 16:958970-958992 CCCTCGCTGTGCCGGGGATGCTG 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1132637437 16:958997-959019 CTACCACTGTGGATGGCAGACGG 0: 1
1: 0
2: 0
3: 17
4: 325
1132637430_1132637441 30 Left 1132637430 16:958970-958992 CCCTCGCTGTGCCGGGGATGCTG 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1132637441 16:959023-959045 CATCTGACCCAGATAATGAAGGG 0: 1
1: 0
2: 1
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132637430 Original CRISPR CAGCATCCCCGGCACAGCGA GGG (reversed) Intronic