ID: 1132639635

View in Genome Browser
Species Human (GRCh38)
Location 16:971684-971706
Sequence TACACTCTGATGACTGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132639625_1132639635 19 Left 1132639625 16:971642-971664 CCCAATGCCCCAAACAGAACATG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG 0: 1
1: 0
2: 0
3: 19
4: 114
1132639628_1132639635 12 Left 1132639628 16:971649-971671 CCCCAAACAGAACATGAAGGAGG 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG 0: 1
1: 0
2: 0
3: 19
4: 114
1132639630_1132639635 11 Left 1132639630 16:971650-971672 CCCAAACAGAACATGAAGGAGGA 0: 1
1: 0
2: 2
3: 42
4: 335
Right 1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG 0: 1
1: 0
2: 0
3: 19
4: 114
1132639631_1132639635 10 Left 1132639631 16:971651-971673 CCAAACAGAACATGAAGGAGGAC 0: 1
1: 0
2: 1
3: 13
4: 212
Right 1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG 0: 1
1: 0
2: 0
3: 19
4: 114
1132639626_1132639635 18 Left 1132639626 16:971643-971665 CCAATGCCCCAAACAGAACATGA 0: 1
1: 0
2: 0
3: 18
4: 157
Right 1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG 0: 1
1: 0
2: 0
3: 19
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132639635 Original CRISPR TACACTCTGATGACTGGAGC GGG Intronic
902258688 1:15207556-15207578 GCCACTCTGATGTCTGGAGCTGG + Intronic
903518239 1:23927296-23927318 GACACTCAGCTGACTGGAGTTGG + Intergenic
905468410 1:38173529-38173551 TACTCACGGATGATTGGAGCAGG + Intergenic
905478605 1:38246090-38246112 GACACTTTGCTGAATGGAGCTGG + Intergenic
906320667 1:44813521-44813543 TACCCCCTGCTGAGTGGAGCTGG - Intronic
906536357 1:46552906-46552928 TCCTCTTTGATGACTGGAGGTGG - Intergenic
909738328 1:78995523-78995545 TAAACTCTGATCTCTGGAGCTGG - Intronic
915744789 1:158147518-158147540 TACTCTGTGATCACTAGAGCAGG + Intergenic
916205434 1:162311742-162311764 TACACTCTGGTGACTGTTGTGGG - Intronic
917251026 1:173060818-173060840 TACTCTTTGATGACTGGTGCAGG - Intergenic
917504519 1:175615666-175615688 TACACTCTAATTCCTGAAGCAGG - Intronic
922317875 1:224458455-224458477 TTCTCTCTGATGTCAGGAGCTGG - Intronic
924468194 1:244316538-244316560 TGCTCTCTGGTGACTGGAGATGG + Intergenic
1065046177 10:21749176-21749198 CAAACTCTGATGACTGCATCTGG + Intergenic
1069625164 10:69863309-69863331 TACACTCTGCCTGCTGGAGCAGG - Intronic
1074350769 10:112734446-112734468 TTCACTCTGATTAATGGACCAGG - Intronic
1074752567 10:116600800-116600822 TACCTTCTGTTGAGTGGAGCTGG - Intronic
1076202397 10:128568982-128569004 AACACACTGATGCCTGCAGCTGG + Intergenic
1079073203 11:17366269-17366291 TACTATGTGATGACTGGAGATGG - Intronic
1079647791 11:22888992-22889014 TACAGTTTAATGAGTGGAGCAGG - Intergenic
1080713363 11:34772153-34772175 TGCACTCTCATGAGTGGTGCTGG + Intergenic
1080899727 11:36478167-36478189 TAGACTCTGATGGTGGGAGCTGG - Intergenic
1083946402 11:65925406-65925428 TTCACTCTGATGATGGGAGGTGG - Intergenic
1087071983 11:94090221-94090243 TACAAGCTGAAGACTGGTGCTGG + Intronic
1089079593 11:115764596-115764618 TCCACCCTGATGACTGGGGTGGG + Intergenic
1092124291 12:6064823-6064845 AACCCTCTGATGTTTGGAGCTGG - Intronic
1092509198 12:9135571-9135593 TACAGTATGATGACTGTATCAGG + Intergenic
1094105532 12:26807459-26807481 TACCCTCTGATGCCTGCAGCAGG - Intronic
1094108328 12:26835787-26835809 TATAGTCTGGGGACTGGAGCTGG + Intergenic
1096759356 12:53827240-53827262 TACTCTCTGCTGACAGGAGTGGG + Intergenic
1100106703 12:91183828-91183850 TATACTTTGATGGCTGGAGGAGG - Intergenic
1100186233 12:92144084-92144106 TACAATATGATGACTGTATCAGG - Exonic
1102820898 12:115908404-115908426 TACACTCTCATGAGGGGGGCTGG - Intergenic
1106114242 13:26803278-26803300 TAAACACTGATGAGTGCAGCAGG + Intergenic
1108723099 13:53152035-53152057 TACATTATGATAACTGGAGCTGG - Intergenic
1113563060 13:111299117-111299139 TCCATTCTGAGGAGTGGAGCAGG + Intronic
1114021742 14:18485900-18485922 AACACTCAGATCACTGCAGCAGG - Intergenic
1116094838 14:40353904-40353926 TACACTCTGGTGACTGTTGTGGG + Intergenic
1117540325 14:56740746-56740768 CACCCTCTGATGACTGGGACGGG - Intergenic
1119928385 14:78519346-78519368 ACCACAATGATGACTGGAGCAGG - Intronic
1121033972 14:90683687-90683709 TACACTCTGCTGAGTGGGTCAGG + Intronic
1123103098 14:105818927-105818949 TACACTCTGAGGCCAGGACCGGG + Intergenic
1124931275 15:34121946-34121968 TTCACTCTGACCACTGGTGCAGG + Intergenic
1127060149 15:55174148-55174170 TATACTCCGGAGACTGGAGCAGG + Intergenic
1130224461 15:82046506-82046528 CCAACTCTGATGCCTGGAGCCGG + Intergenic
1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG + Intergenic
1132639635 16:971684-971706 TACACTCTGATGACTGGAGCGGG + Intronic
1133446251 16:5863390-5863412 GACACTCTGATGACTGCTGATGG + Intergenic
1134431211 16:14208272-14208294 AACACTCTGATGACAACAGCTGG - Intronic
1138729732 16:59182059-59182081 AACACTCTGATGACAGGTGCTGG + Intergenic
1143408166 17:6691762-6691784 ATCACTCTGATGTCTGGAGTGGG - Intronic
1152998611 18:432109-432131 TACACTCTTAGGTCTGGAACTGG + Intronic
1153709904 18:7787644-7787666 CACACTCAGATGACTGCAGTGGG + Intronic
1154274610 18:12948207-12948229 AACGCTCTGATCGCTGGAGCAGG - Exonic
1156078776 18:33311141-33311163 TACATTCTCCTCACTGGAGCAGG + Intronic
1160020686 18:75178475-75178497 AACAGTCTGATGATTGGTGCTGG + Intergenic
1164825396 19:31281540-31281562 CACACTCAGCTGACTGCAGCAGG - Intronic
1164986632 19:32653209-32653231 TAAATTCTGAGAACTGGAGCAGG + Intronic
1165441397 19:35830357-35830379 TAGACTCGGTTGACTTGAGCAGG + Intronic
1165527719 19:36370231-36370253 TACACTGTGCTGCCTTGAGCTGG - Intronic
929666680 2:43838960-43838982 TTCACTCTGTTTCCTGGAGCAGG - Exonic
932853491 2:75210524-75210546 AACACTCTGATGAGTGGTGCTGG + Intergenic
933696297 2:85220874-85220896 TATAATCTGAGCACTGGAGCTGG - Intronic
939468348 2:142586823-142586845 TTCACTCTGATTACTGGTGCAGG - Intergenic
939524901 2:143280636-143280658 TACATTTTGATGAATGAAGCTGG - Intronic
941544808 2:166835300-166835322 TACACTCTGAGGCCTGTAGCGGG - Intergenic
944056635 2:195528913-195528935 CACACTCTGAGGACTGTTGCGGG + Intergenic
945212308 2:207396219-207396241 TACACTCTGGTGACTGTTGTGGG + Intergenic
948733950 2:239986404-239986426 TACACTTAGATGACAGGGGCTGG + Intronic
1171569312 20:26233208-26233230 TACACCTTGATGAGTGGATCTGG - Intergenic
1180281582 22:10700977-10700999 TACACTTTGATGAGTGGATCTGG + Intergenic
1180446202 22:15416246-15416268 AACACTCAGATCACTGCAGCAGG - Intergenic
1182287496 22:29257016-29257038 TCCTCTCTGAGGATTGGAGCAGG + Intronic
1185103162 22:48852536-48852558 CACCCTCTGATCACTGGCGCAGG - Intergenic
1203238824 22_KI270732v1_random:33114-33136 TACACTTTGATGAGTGGATCTGG + Intergenic
950873988 3:16253669-16253691 TAGGCTCTGAAGGCTGGAGCAGG + Intergenic
950904365 3:16524447-16524469 TATAGTCAGATGGCTGGAGCGGG + Intergenic
952302033 3:32111778-32111800 TTTGCTCTGATGACTGAAGCTGG + Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
954868299 3:53748237-53748259 TGCACACTGATGGCAGGAGCTGG - Intronic
957109513 3:75934940-75934962 TACACTTTGATGAGTGGATCTGG + Intronic
957459921 3:80502922-80502944 TAGACTCTGACCACTGGAGGTGG + Intergenic
957738297 3:84230403-84230425 TACACTCTGGGGACTGTTGCGGG - Intergenic
958511844 3:95059957-95059979 TACACTCTGGGGACTGTTGCGGG - Intergenic
960188586 3:114675201-114675223 TCCACTTTGATGACTACAGCTGG - Intronic
960456455 3:117878602-117878624 TACATTTTGGTGACTGGAGGTGG + Intergenic
970319264 4:14859874-14859896 TAGACTCTGATGAGTGAACCAGG + Intergenic
977568240 4:98603848-98603870 TGTTCTCTGATGACTGGAGCTGG - Intronic
980146190 4:128986924-128986946 TACACTGTGCTGTCTGGAGTTGG - Intronic
982301548 4:153883690-153883712 TACACTCTGAAGCCTGGTGGAGG + Intergenic
982974867 4:162042927-162042949 TACACTCTGGTGACTGTTGTGGG + Intronic
983837931 4:172415808-172415830 TCCATTCTGATTACTGGTGCAGG - Intronic
984706542 4:182851268-182851290 CACACTCTGAGGAGTGGAGGGGG - Intergenic
995084063 5:108087081-108087103 AACACTCTGGTGAATGGAGCTGG + Intronic
995134745 5:108668973-108668995 TACATTCTGAAGGCTGGTGCTGG - Intergenic
996140886 5:119907441-119907463 TAGACTCTGGGGACTTGAGCGGG - Intergenic
996249946 5:121317291-121317313 AGCACTCTGATGACTGATGCTGG + Intergenic
1000554533 5:162709017-162709039 TTCATTCTGATGACTGTGGCGGG - Intergenic
1002297136 5:178238001-178238023 GACACTCTGCTCCCTGGAGCTGG + Exonic
1004602216 6:17161292-17161314 TAAACTCTGAAGACTGGGGTTGG - Intergenic
1005456087 6:26021229-26021251 TACACTCTGAAGGCTGAGGCAGG + Intergenic
1006055082 6:31378162-31378184 TACAGTGAGATGACTGGAGGTGG - Intergenic
1006762358 6:36474234-36474256 TACACTCTGGTGACTGTTGTGGG - Intronic
1010673613 6:78716362-78716384 TCCTGTCTGATTACTGGAGCTGG + Intergenic
1010867926 6:81003266-81003288 TACAGTCTGTTCACGGGAGCTGG + Intergenic
1015592014 6:134831385-134831407 TTCACACTGATGCCTGGAACTGG + Intergenic
1017818857 6:158034530-158034552 TACCCTCTGAACACTGGAGCAGG - Intronic
1020751702 7:12148865-12148887 TACTCTCTCATACCTGGAGCTGG - Intergenic
1024237041 7:47406659-47406681 TACACCCTGAAGACTGCAGATGG - Intronic
1025190740 7:56893672-56893694 AGCAATCTGATCACTGGAGCAGG + Intergenic
1025681203 7:63683252-63683274 AGCAATCTGATCACTGGAGCAGG - Intergenic
1027870947 7:83707511-83707533 TATACTCTTATGACTGCAACTGG + Intergenic
1029976340 7:104838046-104838068 TAAGCTCTGATTACTGGAGCTGG - Intronic
1034974188 7:155438418-155438440 GCCAATCTGATGACTGGAGAGGG - Intergenic
1037980548 8:23250290-23250312 TACACTCTGAGCACAGGAGGAGG - Intronic
1045277156 8:100718346-100718368 TAAACTATGGTGACTGGAGTGGG + Intronic
1047344860 8:124017697-124017719 TACGCTCTGCTGGCAGGAGCTGG + Exonic
1048636382 8:136300404-136300426 TCAACTCTGATCACTGGAACTGG + Intergenic
1050747686 9:8896067-8896089 AACACTCTGATGTGTGGAGTTGG - Intronic
1050857605 9:10380069-10380091 GCCACTCTGATGACTGAGGCAGG - Intronic
1057582324 9:96298447-96298469 TTCACAGTGATCACTGGAGCAGG - Exonic
1057900275 9:98943283-98943305 TACATTCTGATGAAGGGGGCAGG + Intronic
1058582002 9:106468525-106468547 TACACTCTGATGAGCTGGGCAGG - Intergenic
1059350022 9:113658017-113658039 ACCACTCTGATGAATGGAGAAGG - Intergenic
1186652131 X:11572348-11572370 CACACTCTGATGACTGTTGTGGG - Intronic
1186666565 X:11722743-11722765 TACACTCTGAAGGTTTGAGCAGG - Intergenic
1187716857 X:22111217-22111239 TTCACTCTGAGGGCTGGAGCTGG + Intronic
1188067296 X:25678185-25678207 CACACTCTGATGACTACAACAGG + Intergenic
1189053940 X:37678661-37678683 TACAAACTGATGACTGAAACAGG - Intronic
1189511893 X:41670993-41671015 TACAGGCTGATGGCTTGAGCAGG + Intronic
1190486224 X:50927607-50927629 CACACTCTGATGACTGTAGTTGG + Intergenic
1196707657 X:118729549-118729571 AACACTCTGAGGATTAGAGCTGG - Intronic
1197106750 X:122725862-122725884 AACACTCTGATGACAAGTGCTGG - Intergenic
1201888678 Y:18917386-18917408 TCCACTCAGATGCCTGGAGCAGG - Intergenic