ID: 1132640213

View in Genome Browser
Species Human (GRCh38)
Location 16:974758-974780
Sequence CTGCCAGGCCGGGGTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 492}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640213_1132640227 7 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640227 16:974788-974810 CTCCTCGGGGCCATTGTCCCTGG 0: 1
1: 0
2: 1
3: 13
4: 128
1132640213_1132640231 17 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640231 16:974798-974820 CCATTGTCCCTGGCATGCGGTGG 0: 1
1: 0
2: 1
3: 16
4: 313
1132640213_1132640222 -7 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640222 16:974774-974796 CTGGCAGCTCCCGCCTCCTCGGG 0: 1
1: 0
2: 2
3: 33
4: 306
1132640213_1132640221 -8 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640221 16:974773-974795 CCTGGCAGCTCCCGCCTCCTCGG 0: 1
1: 0
2: 3
3: 81
4: 857
1132640213_1132640234 30 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640234 16:974811-974833 CATGCGGTGGCAGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 122
1132640213_1132640223 -6 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640223 16:974775-974797 TGGCAGCTCCCGCCTCCTCGGGG 0: 1
1: 0
2: 0
3: 19
4: 207
1132640213_1132640229 14 Left 1132640213 16:974758-974780 CCCCCAGCACCCCGGCCTGGCAG 0: 1
1: 1
2: 2
3: 44
4: 492
Right 1132640229 16:974795-974817 GGGCCATTGTCCCTGGCATGCGG 0: 1
1: 0
2: 1
3: 21
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640213 Original CRISPR CTGCCAGGCCGGGGTGCTGG GGG (reversed) Intronic