ID: 1132640468

View in Genome Browser
Species Human (GRCh38)
Location 16:976014-976036
Sequence AGGGGCCTCATGAACTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640462_1132640468 6 Left 1132640462 16:975985-976007 CCTCATGAACTCTGTGGACATTC 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1132640468 16:976014-976036 AGGGGCCTCATGAACTCTGAAGG 0: 1
1: 0
2: 0
3: 40
4: 384
1132640460_1132640468 18 Left 1132640460 16:975973-975995 CCGGGCAAGGGGCCTCATGAACT 0: 1
1: 0
2: 3
3: 9
4: 134
Right 1132640468 16:976014-976036 AGGGGCCTCATGAACTCTGAAGG 0: 1
1: 0
2: 0
3: 40
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640468 Original CRISPR AGGGGCCTCATGAACTCTGA AGG Intronic
900457747 1:2785689-2785711 AGGGGCCTCAGGAACACCCACGG - Intronic
901464385 1:9411975-9411997 ATGGGTCTCATGAGATCTGATGG + Intergenic
901470284 1:9451251-9451273 AAGGGCCTCACGAGGTCTGACGG - Intergenic
901724383 1:11229371-11229393 AAGGACCTCAAGGACTCTGACGG + Intronic
902788226 1:18746614-18746636 GGTGGCCTCATGAACCCAGATGG - Intronic
906183551 1:43841631-43841653 CTGGGCCTCAGGAACTATGATGG + Intronic
906763850 1:48408797-48408819 ATGGGTCTCATGAGATCTGATGG - Intronic
906785973 1:48616294-48616316 AGAGGCCTCCTGGAATCTGAGGG - Intronic
908828853 1:68159491-68159513 AGGGGCCTCACTCTCTCTGAGGG + Intronic
909054358 1:70804710-70804732 ATGGGTCTCATGACATCTGATGG + Intergenic
909104388 1:71390937-71390959 ATGGGTCTCATGAGATCTGATGG + Intergenic
909105319 1:71398872-71398894 ATGGGTCTCATGAGATCTGATGG + Exonic
910309225 1:85804655-85804677 ATGGGTCTCATGAGATCTGATGG - Intronic
910565313 1:88636808-88636830 ATGGGTCTCATGAGATCTGATGG + Intergenic
910606989 1:89097813-89097835 ATGGGTCTCATGAAATCTGATGG + Intergenic
910903736 1:92150946-92150968 AGTGGTCCCATGAACCCTGAAGG + Intergenic
911686397 1:100781787-100781809 ATGGGTCTCATGAGATCTGATGG - Intergenic
912147408 1:106810012-106810034 ATGGGTCTCATGATATCTGATGG + Intergenic
912182830 1:107238634-107238656 ATGAGTCTCATGAAATCTGATGG + Intronic
912529748 1:110311783-110311805 CGTGGCCTCTTGAAGTCTGAGGG - Intergenic
912609338 1:111027662-111027684 ATGGGTCTCATGAGATCTGATGG + Intergenic
912610275 1:111035212-111035234 AGGGGTCTCATGAGGTCTGGTGG + Intergenic
915513811 1:156401263-156401285 AGGGGCCTGATACACCCTGAGGG - Intergenic
915831903 1:159139230-159139252 AGGGACCACATGCTCTCTGAAGG + Intronic
917219499 1:172712994-172713016 AAGGGGTTCATGAACTCAGATGG - Intergenic
918079356 1:181193793-181193815 ATGGGTCTCATGAGATCTGATGG + Intergenic
918886729 1:190202677-190202699 ATGGGTCTCATGAGATCTGATGG + Intronic
919163582 1:193863466-193863488 ATGAGTCTCATGAAATCTGATGG + Intergenic
922115199 1:222606871-222606893 ATGGGTCTCATGAGATCTGATGG - Intergenic
923977910 1:239285559-239285581 ATGGGTCTCATGAGATCTGATGG - Intergenic
1063127471 10:3148458-3148480 AGGGGGCACATGAACTCTCGAGG - Intronic
1063352808 10:5372292-5372314 ATGGGCAACCTGAACTCTGACGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064556281 10:16550095-16550117 TGGGATCTCATGAAATCTGATGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067956423 10:50795975-50795997 AGAAGTCTCATGAGCTCTGATGG + Intronic
1068013637 10:51486018-51486040 AGGGGCCTCAAGAAATTGGAGGG - Intronic
1068559398 10:58496422-58496444 ATGGGTCTCATGAGATCTGATGG + Intergenic
1068747621 10:60552872-60552894 ATGGGTCTCATGAGATCTGAAGG + Intronic
1069155996 10:65031934-65031956 ATGGGTCTCATGAATTCTGATGG - Intergenic
1070284999 10:75076436-75076458 AGGAGCCTCATGAACACAGCAGG - Intergenic
1070368269 10:75757244-75757266 AGGGGCCTCAGGTTCTCTGCTGG + Intronic
1070542061 10:77423025-77423047 GGTGTCCACATGAACTCTGAAGG + Intronic
1070915735 10:80153535-80153557 GGGGGCCTCCTGAATTGTGATGG - Exonic
1072791178 10:98318914-98318936 AGGGGCTTTCTGAACTCTCATGG + Intergenic
1072852787 10:98914177-98914199 ATGGGTCTCATGAGATCTGATGG + Intronic
1073334807 10:102698504-102698526 GGGGGGCTCATGAACTTAGATGG - Intronic
1073653556 10:105387666-105387688 AGGGGCCTCACCAAATCTGCTGG + Intergenic
1074388002 10:113032419-113032441 AGGGGCCTCCTTAAATCTGGTGG + Intronic
1075477930 10:122752746-122752768 AGGGGCCACCAGAACCCTGATGG + Intergenic
1075571109 10:123546425-123546447 ATGGGTCTCATGAGATCTGATGG + Intergenic
1075826018 10:125357605-125357627 ATGGGCATCATGAGATCTGATGG - Intergenic
1076225563 10:128772154-128772176 ATGGGTCTCATGAGATCTGATGG + Intergenic
1077543658 11:3159560-3159582 AGGGGACTCCTGACCTGTGAAGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077631275 11:3812657-3812679 TGGGGCCTTCAGAACTCTGAGGG - Intronic
1077710147 11:4528198-4528220 AGAGTTCTCATGAAATCTGATGG + Intergenic
1078760610 11:14248450-14248472 GGAGGCCTCAGGAAGTCTGAGGG - Intronic
1079129163 11:17737544-17737566 GGGGGCCTGGTGAACTCTTAAGG + Intronic
1080796719 11:35571006-35571028 ATGGGACTCATGAGATCTGATGG - Intergenic
1083120250 11:60505260-60505282 ATGGGTCTCATGAGATCTGATGG - Intronic
1083226903 11:61290992-61291014 AGGGTCCTCCTGAATTCTGTTGG + Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084326319 11:68402477-68402499 CAGGGCCGGATGAACTCTGAGGG - Intronic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1087226487 11:95606580-95606602 ATGGGTCTCATGAGATCTGATGG - Intergenic
1087255413 11:95947835-95947857 ATGGGTCTCATGAGATCTGATGG - Intergenic
1087838225 11:102896017-102896039 ATGGGTCTCATGAGATCTGATGG + Intergenic
1088001173 11:104882798-104882820 ATGAGTCTCATGAAATCTGATGG + Intergenic
1088879643 11:113963329-113963351 AGGGGCCAGATGAGCTATGAGGG + Intergenic
1090346716 11:126077425-126077447 ATGGGCCTCATGAGCTCTAGAGG - Intergenic
1091958479 12:4669415-4669437 AGGGGCCTCAAGCTATCTGAAGG + Intronic
1092404081 12:8204586-8204608 AGAGGCCTGATGAGGTCTGAAGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093352974 12:18127154-18127176 ATGGGTCTCATGAGATCTGATGG + Intronic
1094182318 12:27604956-27604978 ATGGGTCTCATGAGATCTGATGG - Intronic
1095928674 12:47605014-47605036 ATGGGTCTCATGAGATCTGATGG - Intergenic
1097247547 12:57614862-57614884 AGGGCCCTCAGGAAGTCTGGGGG - Intronic
1097400572 12:59123914-59123936 ATGGGTCTCATGAGATCTGATGG - Intergenic
1097654549 12:62343876-62343898 ATGGGTCTCATGAGATCTGATGG - Intronic
1098489422 12:71058331-71058353 ATGGGTCTCATGAGATCTGATGG + Intronic
1098792226 12:74837835-74837857 ATGGGTCTCATGAGATCTGACGG + Intergenic
1099990866 12:89719438-89719460 ATGGGTCTCATGAGATCTGATGG + Intergenic
1100456648 12:94758107-94758129 AGGGGCTTCAGGAATTCTCAAGG + Intergenic
1101005679 12:100398842-100398864 ATGGGTCTCATGAGATCTGATGG + Intronic
1101464727 12:104936606-104936628 ATGGGTCTCATGAGATCTGATGG - Intronic
1102588771 12:113941881-113941903 AGGGGTCTCATGATGTCTTAGGG + Intronic
1102596981 12:114000463-114000485 ATGGGTCTCATGAGATCTGATGG - Intergenic
1103639296 12:122336267-122336289 AGGGGCCTCATTCAATATGAAGG + Intronic
1103881303 12:124167932-124167954 ATGAGCCTCATGAGATCTGATGG - Intronic
1104799160 12:131541714-131541736 ATGAGTCTCATGAGCTCTGATGG - Intergenic
1105702309 13:22942764-22942786 AGGTGCCTCATGACCTCTACAGG - Intergenic
1105854929 13:24364548-24364570 AGGTGCCTCATGACCTCTACAGG - Intergenic
1105934647 13:25087942-25087964 AGGGGCTTCAAGAACTCATAGGG + Intergenic
1106128926 13:26923299-26923321 AGGGGTCTCAAGAACTGTGAAGG + Intergenic
1106791061 13:33155064-33155086 AGTGACCTCATGCACTCTCAGGG + Intronic
1107019838 13:35740148-35740170 AGAAGCCTCATGAGATCTGATGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107554620 13:41507155-41507177 ATGGGTCTCATGAGATCTGATGG - Intergenic
1107951903 13:45470492-45470514 TAAGGCCTCATGAACTCTGATGG + Intronic
1108968807 13:56345800-56345822 AGGAGCCTAATGAAATATGATGG + Intergenic
1110377727 13:74813459-74813481 ATGGGTCTCATGAGATCTGATGG + Intergenic
1110377983 13:74815294-74815316 ATGGGTCTCATGAGATCTGATGG + Intergenic
1110559888 13:76899456-76899478 ATGGGTCTCATGAGATCTGATGG - Intergenic
1111528890 13:89510801-89510823 ATGGGTCTCATGAAATATGATGG - Intergenic
1111737964 13:92165627-92165649 AGGGGCCTCATGAGAGGTGACGG - Intronic
1114984409 14:28209302-28209324 ATGGGTCTCATGAGATCTGATGG + Intergenic
1115113539 14:29853834-29853856 ATGGGTCTCATGAGATCTGATGG + Intronic
1115404299 14:32997549-32997571 ATGGGTCTCATGAGATCTGATGG + Intronic
1116387273 14:44347280-44347302 ATGGGCCTCATGAGATCTGATGG + Intergenic
1116784328 14:49270389-49270411 TGAGGCCTCATGAGATCTGATGG + Intergenic
1118069742 14:62232714-62232736 ATGGGTCTCATGAGATCTGATGG + Intergenic
1118598151 14:67452007-67452029 ATGGGTCTCATGAGATCTGATGG + Intronic
1118763791 14:68896523-68896545 AAGAACCCCATGAACTCTGAGGG + Intronic
1120606245 14:86582301-86582323 ATGGGTCTCATGAGATCTGATGG + Intergenic
1121429104 14:93874323-93874345 AGGAGTCTCATGAGATCTGATGG + Intergenic
1121991199 14:98559466-98559488 ATGGGTCTCATGAGATCTGATGG - Intergenic
1122063682 14:99157284-99157306 TGGGGCCTCATGAACCTTGATGG - Intergenic
1122843817 14:104479846-104479868 AGGTGCCTCGTGACCTCTGCAGG - Intronic
1122854812 14:104554957-104554979 AGGGGCCGCAGCCACTCTGAGGG - Intronic
1124003796 15:25780360-25780382 AGGGTCTTCCTGATCTCTGAGGG + Intronic
1124236059 15:27990184-27990206 AGGGGCCTCCTGATCTCTTCAGG + Intronic
1125246617 15:37647858-37647880 TGAGTCCTCATGAAATCTGATGG + Intergenic
1127123840 15:55793450-55793472 ATGGGTCTCATGAGATCTGATGG + Intergenic
1128270204 15:66302674-66302696 AGGTGACCCATGAGCTCTGAAGG - Intronic
1128349613 15:66880208-66880230 AGGTGCCTCATGAGCACTCAGGG + Intergenic
1131642083 15:94303582-94303604 ATGGGTCTCATGAGATCTGATGG - Intronic
1131914696 15:97251993-97252015 ACGGGTCTCATGAGATCTGATGG + Intergenic
1132640468 16:976014-976036 AGGGGCCTCATGAACTCTGAAGG + Intronic
1134254388 16:12599713-12599735 AGAGGCTTCCTGAACTGTGAAGG - Intergenic
1136369148 16:29825175-29825197 AGGAGCCTCATGACACCTGAGGG + Intronic
1137748561 16:50841635-50841657 GGGGACCTCATTAACTCAGAAGG + Intergenic
1144178306 17:12729491-12729513 AGAGGCCTCTAGAAATCTGAGGG + Intronic
1148123822 17:45226829-45226851 TGGGGACCCTTGAACTCTGATGG + Intronic
1150125413 17:62631727-62631749 AGTGTCCTCAGGATCTCTGAGGG + Intronic
1151007831 17:70458647-70458669 ATGGGTCTCATGAAATCTGATGG - Intergenic
1151174514 17:72276027-72276049 ATGGGCCTCACGAGATCTGATGG + Intergenic
1151501131 17:74489803-74489825 ATGGGTCTCATGAGATCTGATGG - Intergenic
1151504573 17:74518743-74518765 ATGGGTCTCATGAGATCTGATGG + Intergenic
1151829882 17:76543257-76543279 AGGAGCCTCAGGAACTCAGAGGG - Exonic
1152092849 17:78256646-78256668 CGGGGCCTGATGACCTCTCAGGG + Intergenic
1152690383 17:81715364-81715386 AGGGGCCACAGGGACCCTGAGGG - Intronic
1153455139 18:5272314-5272336 ATGGGTCTCATGAGATCTGATGG - Intergenic
1154049634 18:10941955-10941977 AGGGGTCTCACGAGATCTGATGG + Intronic
1156367991 18:36447260-36447282 AGGGACCACATTAACTCTGTAGG + Intronic
1156543314 18:37938680-37938702 ATGGGTCTCATGAGATCTGATGG + Intergenic
1157031653 18:43917704-43917726 AGGAACCTCATCAACTCAGATGG - Intergenic
1158101494 18:53834703-53834725 AGAGGCCTCCTGAACTGGGATGG - Intergenic
1159180404 18:64894528-64894550 ATAAGCCTCATGATCTCTGATGG - Intergenic
1159641344 18:70865692-70865714 ATGGGTCTCATGAGATCTGATGG + Intergenic
1159718993 18:71861651-71861673 ATGGGTCTCATGAGATCTGATGG - Intergenic
1159762923 18:72451227-72451249 ATGGGTCTCATGAGGTCTGATGG - Intergenic
1160252618 18:77216623-77216645 ATGGGTCTCATGAGATCTGATGG + Intergenic
1162612937 19:11770259-11770281 TGGGTTCTCATGAAATCTGACGG - Intronic
1163530224 19:17844363-17844385 AGAGGCTGCATGAACGCTGAGGG + Exonic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1165929160 19:39344853-39344875 AAGGGTCTCTTGATCTCTGAAGG - Intronic
924989746 2:302680-302702 TGGTCCCTCATGAGCTCTGATGG + Intergenic
925250195 2:2427618-2427640 ATGGGCCTCACGAGATCTGATGG - Intergenic
925887035 2:8401957-8401979 TGGGGACTCACGGACTCTGAGGG + Intergenic
927458116 2:23275028-23275050 TGTGGCCTCATGAATTCTCACGG - Intergenic
927943457 2:27120164-27120186 AGGGCCCTGAGGAACTCTGACGG - Intergenic
928826936 2:35434056-35434078 ATGGGTCTCATGAAATCTGATGG - Intergenic
930122304 2:47770013-47770035 AGGGCCCTGTAGAACTCTGAAGG + Intronic
930263253 2:49171104-49171126 ATGGGTCTCATGAGATCTGATGG + Intergenic
931154564 2:59614078-59614100 ATGGGTCTCATGAGATCTGATGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933787517 2:85855222-85855244 ATGGGTCTCATGAGATCTGATGG + Intronic
935094172 2:99927965-99927987 ATGGGTCTCATGAGATCTGATGG + Intronic
935600516 2:104917479-104917501 AGGGGCCTGAGCAAGTCTGAAGG + Intergenic
935733217 2:106083753-106083775 AGGGGTCTCATGAACTTGAATGG - Intergenic
936472909 2:112814595-112814617 ATGGTCTTCTTGAACTCTGAGGG + Intergenic
937806368 2:126150368-126150390 ATGAGTCTCATGAACTCTGATGG - Intergenic
939374757 2:141350072-141350094 GGGGGTCTCATGAAATCTGATGG - Intronic
940187699 2:151005094-151005116 AGGGACCTCATCAGTTCTGAGGG - Intronic
940686454 2:156857099-156857121 ATGGGTCTCATGAGTTCTGATGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941123598 2:161560581-161560603 ATGGGTCTCATGAAATCTGATGG + Intronic
942657121 2:178225766-178225788 ATGGGTCTCATGACATCTGATGG - Intronic
942666603 2:178325999-178326021 TGGGGCCTCATGAAATCAGAGGG + Intronic
944638416 2:201697082-201697104 AGAGAACACATGAACTCTGATGG - Intronic
944808735 2:203307665-203307687 ATGGGTCTCATGAGATCTGATGG + Intergenic
944904020 2:204244642-204244664 CAGGGCCTCATTACCTCTGAAGG + Intergenic
945769360 2:214021467-214021489 ATGGGTCTCATGAGATCTGATGG - Intronic
946608290 2:221430437-221430459 CAGGGCCACATGATCTCTGAGGG - Intronic
947296300 2:228634838-228634860 ATGGGTCTCATGAGATCTGATGG - Intergenic
947442190 2:230133094-230133116 ATGAGCCTCATGAGATCTGACGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947825021 2:233099987-233100009 ATGGGTCTCATGAGATCTGATGG - Intronic
948834151 2:240616569-240616591 AGGGGGCTCATGATATCTGGTGG + Intronic
1169000375 20:2163850-2163872 AGGAGCCCCATGAACTCGGAAGG + Intronic
1169857850 20:10123362-10123384 ATGGGTCTCATGAGGTCTGATGG - Intergenic
1169920414 20:10728974-10728996 AGGGGCAGTAGGAACTCTGAAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172184324 20:33021824-33021846 AGGGGCCTCCTTCACTCAGAGGG + Intronic
1172274826 20:33673828-33673850 TGGGGCCTGAAGAACTCTGGGGG + Intronic
1172357838 20:34292187-34292209 TGGGGCCTCCTGACTTCTGAGGG - Intronic
1173389663 20:42620987-42621009 ATGGGTCTCATGAGATCTGATGG - Intronic
1175342992 20:58246687-58246709 AGGAGCTCAATGAACTCTGATGG + Intergenic
1176688908 21:9880989-9881011 ATGGGTCTCATGAAATCTGATGG - Intergenic
1177213421 21:18098340-18098362 AGGGGCCTCAATAACTCTATAGG + Intronic
1177298414 21:19207212-19207234 TGGGGACTCAGGAGCTCTGATGG - Intergenic
1177513266 21:22117439-22117461 TGAGTTCTCATGAACTCTGATGG - Intergenic
1177883337 21:26719723-26719745 AGGCCCGTGATGAACTCTGAGGG + Intergenic
1178295402 21:31405675-31405697 ATGGGTCTCATGAGATCTGATGG - Intronic
1179285466 21:39974280-39974302 CAGGGCCTCATGCCCTCTGAAGG + Intergenic
1179429692 21:41312003-41312025 ATGGGTCTCATGAGATCTGATGG - Intronic
1179469258 21:41599593-41599615 ATGGGTCTCATGAGATCTGATGG + Intergenic
1184790879 22:46699164-46699186 AAGGGCCTCATGAAATGTGCCGG - Intronic
949301821 3:2592537-2592559 ATGGGTCTCATGAGATCTGATGG + Intronic
950393194 3:12712879-12712901 ATAAGCCTCATGAAATCTGATGG - Intergenic
950855206 3:16098093-16098115 ATGGGACTCATGAGATCTGATGG + Intergenic
952628267 3:35433782-35433804 ATGAGTCTCATGAAATCTGATGG + Intergenic
953097220 3:39790025-39790047 TGAGGTCTCATGAAATCTGATGG + Intergenic
954516800 3:51185743-51185765 ATGGGTCTCATGAGATCTGATGG + Intronic
956308541 3:67853338-67853360 GGGGGGCTCATGGACTATGAGGG + Intergenic
956938455 3:74131019-74131041 ATGGGTCTCATGAGATCTGATGG - Intergenic
956938727 3:74132950-74132972 ATGGGTCTCATGAGATCTGATGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957693351 3:83599894-83599916 TGGGTTCTCATGAGCTCTGATGG + Intergenic
958135362 3:89482689-89482711 AAAGGCCTCATGATCTCTGTTGG - Intergenic
958149274 3:89669735-89669757 AGGGGTCTCATGAGATCTGGTGG + Intergenic
958823610 3:99003816-99003838 ATGGGTCTCATGCAATCTGATGG - Intergenic
959054596 3:101554639-101554661 ATGGGTCTCATGAGATCTGATGG + Intergenic
959216425 3:103455882-103455904 ATGGGTCTCACGAAATCTGATGG + Intergenic
959364189 3:105436063-105436085 ATGGGTCTCATGAGATCTGATGG - Intronic
961128244 3:124441504-124441526 AGGAGGCTCAAGAACTCTGAAGG - Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961347078 3:126270271-126270293 AGGGTGCCCATGGACTCTGAAGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962500336 3:135984950-135984972 ATGGGTCTCATGAGATCTGATGG - Intronic
963011521 3:140775022-140775044 ATGGGTCTCATGAGATCTGATGG - Intergenic
963011803 3:140776978-140777000 ATGGGTCTCATGAGATCTGATGG - Intergenic
963421178 3:145062496-145062518 ATGGGTCTCATGAGATCTGATGG - Intergenic
963952707 3:151220602-151220624 ATGGGTCTCATGAGATCTGATGG + Intronic
963952972 3:151222514-151222536 ATGGGTCTCATGAGATCTGATGG + Intronic
965838953 3:172881421-172881443 ATGGGTCTCATGAGATCTGATGG + Intergenic
966031239 3:175350449-175350471 ATGGGCCTCTGAAACTCTGATGG + Intronic
966043922 3:175527267-175527289 AAGGGCCTCATCAGCTATGACGG - Intronic
966059045 3:175733402-175733424 ATGGGTCTCATGAGATCTGATGG - Intronic
966270239 3:178096279-178096301 ATGGGTCTCATGAGATCTGATGG + Intergenic
967149536 3:186636109-186636131 TGGGTCCTCAGGAACCCTGAAGG + Intronic
967505129 3:190245258-190245280 ATGGGTCTCATGAGATCTGATGG - Intergenic
967633735 3:191777189-191777211 TGGGTTCTCATGAAATCTGATGG + Intergenic
967958989 3:194903600-194903622 ATGGGTCTCATGAGATCTGATGG + Intergenic
969060401 4:4429537-4429559 AGGGGACTCCTGAGCTATGAGGG - Intronic
969391156 4:6892194-6892216 AGGAGCCTCATGAAGTCAGCAGG + Intergenic
969565310 4:7973966-7973988 AGGAGCCTCATGAAGTCTGTTGG + Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969761976 4:9193108-9193130 AGAGGCCTGATGAGGTCTGAAGG - Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970357984 4:15276917-15276939 ATAAGTCTCATGAACTCTGATGG - Intergenic
970707868 4:18826687-18826709 ATGGGTCTCATGAGATCTGATGG - Intergenic
971739758 4:30504175-30504197 ATGTGTCTCATGAAATCTGACGG + Intergenic
971844987 4:31906886-31906908 ATGGGTCTCATGAGATCTGATGG - Intergenic
971884076 4:32420769-32420791 ATGGGGCTCATGAGATCTGATGG - Intergenic
972190786 4:36588064-36588086 ATGGGTCTCATGAGATCTGATGG + Intergenic
972414206 4:38823047-38823069 ATGGGTCTCATGAAATCTGATGG - Intronic
972467378 4:39370269-39370291 ATGGGTCTCATGAGATCTGATGG + Intergenic
972813278 4:42614105-42614127 AGGGGACTCATGAACCAAGATGG + Intronic
972935987 4:44136233-44136255 ATGGGTCTCATGAGATCTGATGG + Intergenic
974360194 4:60867701-60867723 TGGAGCCTCAAGAACTCAGAGGG + Intergenic
976515828 4:85965275-85965297 ATGGGACTCATGAGATCTGATGG - Intronic
977728725 4:100326697-100326719 ATGGGTCTCATGAGATCTGATGG - Intergenic
978028051 4:103902296-103902318 ATGGGCCTCATGAGATCTGATGG - Intergenic
978059397 4:104317694-104317716 ATGGGCCTCACGAAATCTGATGG + Intergenic
978267526 4:106844166-106844188 ATGGGTCTCATGAGATCTGATGG - Intergenic
979389970 4:120117118-120117140 ATGGGTCTCATGAGATCTGATGG - Intergenic
979413925 4:120412880-120412902 TGAGGTCTCATGAAATCTGATGG + Intergenic
979426545 4:120573641-120573663 AGGGGTCTCATGATATCTGATGG - Intergenic
979496016 4:121383180-121383202 ATGGGTCTCATGAGATCTGATGG + Intergenic
980495106 4:133579195-133579217 ATGAGTCTCATGAGCTCTGATGG + Intergenic
980650809 4:135712311-135712333 ATGAGTCTCATGAAATCTGATGG + Intergenic
981362472 4:143863279-143863301 AGGAACCTCATGAAATCTGGGGG + Intergenic
981373198 4:143984042-143984064 AGGAACCTCATGAAATCTGGGGG + Intergenic
981382297 4:144087317-144087339 AGGAACCTCATGAAATCTGGGGG + Intergenic
981400934 4:144313313-144313335 AGGGGTGTAATGAACTCTGTAGG + Intergenic
981934523 4:150224833-150224855 AGGTGCGTCAAGAACTCTGAGGG + Intronic
982102784 4:151984652-151984674 AGGGGCTGCATGAAGTCTGTTGG - Intergenic
982494296 4:156071127-156071149 ATGGGTCTCATGAGATCTGATGG - Intergenic
983250057 4:165333531-165333553 AAGGGCTTCATGAACTATAAGGG - Exonic
983668950 4:170214061-170214083 ATGGGTCTCATGAAATCTGATGG + Intergenic
983669216 4:170216136-170216158 ATGGGTCTCATGAGATCTGATGG + Intergenic
983955203 4:173689463-173689485 AGGGGCCTGAGGTACTGTGAGGG - Intergenic
985342044 4:188964916-188964938 ATGGGTCTCATGAGATCTGATGG + Intergenic
986756883 5:10845025-10845047 ATGGGTCTCATGAGATCTGATGG - Intergenic
986762144 5:10889885-10889907 AGGGGCTCCATGAGCACTGAAGG - Intergenic
987773415 5:22335320-22335342 ATGGGTCTCATGAGATCTGATGG + Intronic
987810274 5:22826199-22826221 ATGGACCTCATGAGATCTGATGG + Intronic
988098368 5:26646255-26646277 ATAGGTCTCATGAAATCTGATGG + Intergenic
988866809 5:35344107-35344129 ATGGGTCTCATGAGATCTGATGG - Intergenic
988888199 5:35582389-35582411 ATGGGTCTCATGAGATCTGATGG - Intergenic
991616170 5:68498903-68498925 ATGGGTCTCATGAGATCTGATGG + Intergenic
992855006 5:80850591-80850613 ATGAGTCTCATGAAATCTGATGG - Intronic
993618298 5:90138441-90138463 AGGGGCCTATAGAGCTCTGAGGG - Intergenic
994542662 5:101120682-101120704 ATGGGTCTCATGAGATCTGATGG - Intergenic
994610535 5:102032312-102032334 ATGGGTCTCATGAGATCTGATGG + Intergenic
996460035 5:123731589-123731611 ATGGGTCTCATGAGATCTGATGG + Intergenic
996600305 5:125254687-125254709 ATGGGTCTCATGAGATCTGATGG - Intergenic
997634773 5:135397182-135397204 TGGGGCCGCATTAGCTCTGAAGG + Intronic
998639887 5:143997415-143997437 ATGAGTCTCATGAAATCTGATGG + Intergenic
999020967 5:148164772-148164794 ATGGGTCTCATGAGATCTGATGG + Intergenic
1006696719 6:35937082-35937104 ATGGGTCTCATGAGATCTGATGG + Intergenic
1007776233 6:44225984-44226006 TGGGGCCCCATGAAGCCTGAGGG + Intronic
1008153720 6:47988631-47988653 ATAGGTCTCATGAAATCTGATGG + Intronic
1009825184 6:68857929-68857951 ATGGGTCTCATGAGATCTGATGG + Intronic
1009876535 6:69512510-69512532 ATGGGTCTCATGAGATCTGATGG + Intergenic
1011152702 6:84291454-84291476 ATGGGTCTCATGAGATCTGATGG - Intergenic
1011920519 6:92570462-92570484 ATGGGTCTCATGAGATCTGATGG - Intergenic
1013039765 6:106421928-106421950 ATGGGTCTCAGGAAATCTGATGG - Intergenic
1013693568 6:112673889-112673911 AGGGGTCTCATGAGATCTGATGG - Intergenic
1014068274 6:117151800-117151822 ATGGGACTCATGAAATATGATGG - Intergenic
1014933923 6:127364748-127364770 AGGGTCCTCATGAGAGCTGATGG + Intergenic
1015217023 6:130762067-130762089 ATGGGTCTCATGAGATCTGATGG - Intergenic
1015369333 6:132433512-132433534 ATGAGTCTCATGAAATCTGATGG + Intergenic
1015490817 6:133823639-133823661 ATGGGTCTCATGAGATCTGATGG - Intergenic
1015945468 6:138495904-138495926 ATGAGTCTCATGAAATCTGATGG - Intronic
1016139604 6:140592997-140593019 ATGGGTCTCATGAGATCTGATGG + Intergenic
1016230758 6:141801077-141801099 ATGAGTCTCATGAAATCTGATGG + Intergenic
1016358789 6:143246424-143246446 ATGGGTCTCATGAGATCTGATGG - Intronic
1016537496 6:145125299-145125321 ATGGGTCTCATGAGATCTGATGG + Intergenic
1016649731 6:146449575-146449597 ATGGGTCTCATGAAATCTGATGG - Intergenic
1017618083 6:156266251-156266273 ATGGGTCTCATGAGATCTGATGG - Intergenic
1018473024 6:164113101-164113123 ATGGGTCTCATGAGATCTGATGG + Intergenic
1019505703 7:1389486-1389508 CGGGGCCTCATGAAGACAGACGG - Intergenic
1020145737 7:5641305-5641327 ACTGGCCTCATCAAATCTGAAGG - Exonic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020782576 7:12535384-12535406 ATGGGTCTCATGAGATCTGATGG - Intergenic
1021035138 7:15788732-15788754 TGAGTCCTCATGAGCTCTGATGG - Intergenic
1021177208 7:17462855-17462877 AAGGGACTCATGAAATCTGAGGG + Intergenic
1022458059 7:30576685-30576707 ATGGGTCTCATGAGATCTGATGG - Intergenic
1023619580 7:42055986-42056008 ATGGGTCTCATGAGATCTGATGG + Intronic
1024169460 7:46769010-46769032 AGAGTTCTCATGAAATCTGATGG - Intergenic
1026559605 7:71437430-71437452 AGGGACCTGATCAACTGTGATGG - Intronic
1028250216 7:88531340-88531362 ATGGGTCTCATGAGATCTGATGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030558975 7:111062300-111062322 ATGAGACTCATGAAATCTGATGG - Intronic
1030621542 7:111796033-111796055 AAGGTCCTCATGATCTCTGCTGG + Intronic
1030733084 7:113012998-113013020 ACAGGCCTCATGAGATCTGATGG + Intergenic
1030783009 7:113624966-113624988 ATGGGTCTCATGAGATCTGATGG - Intergenic
1031650606 7:124284988-124285010 AGGGTTCTCATGAGATCTGATGG + Intergenic
1032565062 7:132933321-132933343 AGGGGCCACGTGATTTCTGATGG + Intronic
1033805252 7:144946843-144946865 ATGGGTCTCATGAAATCTGATGG - Intergenic
1036123289 8:6040888-6040910 ATGGGTCTCATGAGATCTGATGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036844559 8:12155908-12155930 AGAGGCCTGATGAGGTCTGAAGG + Intergenic
1036865929 8:12398241-12398263 AGAGGCCTGATGAGGTCTGAAGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037200853 8:16250519-16250541 ATGGGTCTCATGAGATCTGATGG - Intronic
1037630849 8:20654225-20654247 AGTGGCATCAGGAACTCTGAGGG + Intergenic
1038124438 8:24655935-24655957 AGGGGCTTAATGAACTATGTTGG - Intergenic
1038746743 8:30261435-30261457 ATGGGTCTCATGAGATCTGATGG + Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038814289 8:30885336-30885358 ATGGGTCTCATGAGATCTGATGG + Intronic
1039076549 8:33695180-33695202 ATGGGTCTCATGAGATCTGATGG + Intergenic
1039485194 8:37904456-37904478 AGGGGCATCAGGGACACTGAAGG - Intergenic
1039575682 8:38622053-38622075 AGGGGCTTCATGGAGTGTGAAGG - Intergenic
1039649163 8:39322043-39322065 ATGGGTCTCATGAGATCTGATGG - Intergenic
1040520833 8:48174621-48174643 AGGGGCCTGATGGACTGGGAAGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041389006 8:57332558-57332580 GGAGGCCTCAAGAAATCTGAGGG + Intergenic
1043993268 8:86781539-86781561 ATGAGTCTCATGAGCTCTGATGG + Intergenic
1044044734 8:87417259-87417281 ATAGGCCTCATGAGATCTGATGG - Intronic
1046674472 8:117093455-117093477 AGGGGGCTCAGGACCACTGAGGG - Intronic
1047149286 8:122242170-122242192 ATGGGTCTCATGAGATCTGATGG + Intergenic
1047531790 8:125683594-125683616 AGCAGCCTCATGCACTCTGATGG + Intergenic
1047876169 8:129140013-129140035 ATGGGTCTCATGAAATCTGATGG + Intergenic
1048027669 8:130601543-130601565 ATGGGTCTCATGACATCTGATGG + Intergenic
1048368898 8:133759806-133759828 AGGGGCCTCAGAGAGTCTGAGGG - Intergenic
1049863003 8:144913211-144913233 ATGGGTCTCATGAGATCTGATGG + Intergenic
1050646351 9:7723764-7723786 AGGGGCCTCATGTACTCACAAGG + Intergenic
1051957328 9:22712184-22712206 ATGGGTCTCATGAGGTCTGATGG + Intergenic
1052787798 9:32845973-32845995 AGAAGTCTCATGAAATCTGATGG - Intergenic
1053477926 9:38395578-38395600 AGGGCCCTGATGAACTCTCTGGG - Intronic
1053780419 9:41600911-41600933 ATGGGTCTCATGAAATCTGATGG + Intergenic
1054168361 9:61811068-61811090 ATGGGTCTCATGAAATCTGATGG + Intergenic
1054669168 9:67769750-67769772 ATGGGTCTCATGAAATCTGATGG - Intergenic
1055083305 9:72289536-72289558 ATGGGTCTCATGAGATCTGATGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057169197 9:92950701-92950723 AGGGCCCTCATGAACTGTGGAGG + Intronic
1057935826 9:99237967-99237989 ATGAGTCTCATGAAATCTGATGG + Intergenic
1059040834 9:110813996-110814018 TGGGTCCTCATGAGATCTGATGG - Intergenic
1059582700 9:115568399-115568421 ATGGGTCTCATGATATCTGATGG + Intergenic
1059704404 9:116807200-116807222 AAGGGACTCAGGAACTCAGATGG + Intronic
1060187294 9:121571515-121571537 AGGGGGCTCAGGAACATTGATGG + Intronic
1060887178 9:127162688-127162710 AGGGGAATTATGAACTCTGTGGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1186387316 X:9122916-9122938 GGGGTCCTGATGAACTGTGAGGG - Intronic
1187397306 X:18930015-18930037 AGGGGCCTGATGAATGCTAATGG - Intronic
1188029766 X:25251348-25251370 ATGGGTCTCATGAGATCTGATGG + Intergenic
1188297898 X:28472306-28472328 ATGGGTCTCATGAGATCTGATGG - Intergenic
1188313915 X:28650432-28650454 AGAAGTCTCATGAAATCTGATGG - Intronic
1188945087 X:36290708-36290730 AGGGGCTACATGAAATTTGATGG - Intronic
1189282501 X:39828713-39828735 AGGGACCTCCTGAACTCAGCAGG - Intergenic
1189403351 X:40693382-40693404 ATGGGTCTCACGAAATCTGATGG + Intronic
1189772273 X:44438319-44438341 ATGGGTCTCATGAGATCTGATGG + Intergenic
1189986971 X:46562112-46562134 AGGGGCCTGAAGAACTCTTCTGG + Intergenic
1191250474 X:58257788-58257810 AGGGGCCGCATGAAACCCGAAGG - Intergenic
1191596041 X:62945127-62945149 ATGGGTCTCATGAGATCTGATGG - Intergenic
1191736513 X:64394160-64394182 ATGGGTCTCATGAGATCTGATGG - Intronic
1193188420 X:78540188-78540210 ATGGGTCTCATGAGGTCTGATGG - Intergenic
1194269616 X:91794905-91794927 ATGGGTCTCATGATATCTGATGG + Intronic
1194429140 X:93779105-93779127 ATGAGCCTCATGAGATCTGATGG - Intergenic
1196125331 X:112092730-112092752 ATGGGTCTCATGAGATCTGATGG + Intergenic
1196230722 X:113217873-113217895 ATGAGTCTCATGAAATCTGATGG - Intergenic
1197103815 X:122689165-122689187 ATGGGTCTCATGAGATCTGATGG + Intergenic
1197301841 X:124790118-124790140 ATGGGTCTCATGAGATCTGATGG - Intronic
1197610775 X:128635789-128635811 ATGGGTCTCATGAGATCTGATGG - Intergenic
1198614300 X:138438580-138438602 ATGGGTCTCATGAGATCTGATGG - Intergenic
1199370654 X:147043511-147043533 AGGGGTCTTATAAACTCTCAGGG + Intergenic
1199491160 X:148402261-148402283 ATGGGCCTCAAGAAATCTGATGG - Intergenic
1201237785 Y:11928205-11928227 GTGGGTCTCATGAAATCTGATGG + Intergenic
1201924198 Y:19267090-19267112 ATGGGTCTCATGAGATCTGATGG - Intergenic