ID: 1132640745

View in Genome Browser
Species Human (GRCh38)
Location 16:977287-977309
Sequence CACACTTGGAGCTCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640745_1132640756 17 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640745_1132640751 4 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640751 16:977314-977336 GCCAAGAAGCTGACTCCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1132640745_1132640753 5 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640753 16:977315-977337 CCAAGAAGCTGACTCCCGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1132640745_1132640757 18 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640757 16:977328-977350 TCCCGAAGGGGGTCTTGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1132640745_1132640754 6 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640754 16:977316-977338 CAAGAAGCTGACTCCCGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98
1132640745_1132640759 19 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640759 16:977329-977351 CCCGAAGGGGGTCTTGAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132640745_1132640755 7 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640755 16:977317-977339 AAGAAGCTGACTCCCGAAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640745 Original CRISPR CACACTTGGAGCTCTGGGCT GGG (reversed) Intronic
900388679 1:2423536-2423558 CTCCCCTGGAGTTCTGGGCTGGG + Intergenic
900719489 1:4166209-4166231 CACATCTGGAGCTCTGCACTGGG + Intergenic
903284432 1:22268094-22268116 CACCCCTGGCGCTCGGGGCTGGG + Intergenic
904037533 1:27566895-27566917 GGCACTTGGAGCTCTGGGCATGG + Intronic
905453425 1:38071525-38071547 AGCACTTAGAGCTCTGGGGTGGG - Intergenic
905457819 1:38100577-38100599 CACAGTCTGAGCCCTGGGCTGGG + Intergenic
906241392 1:44244435-44244457 CACAAATGGAGTTGTGGGCTTGG - Intronic
907310965 1:53538780-53538802 CACACTGACAGCTCTGGGCTGGG + Intronic
908962690 1:69718521-69718543 CAGAACTGGAGCTCTGGGATTGG + Intronic
910089013 1:83440032-83440054 CAGCCTTGGAGTTCTGGTCTTGG - Intergenic
910456424 1:87402360-87402382 CACACTGGGAGATGTGGGTTTGG - Intergenic
910711568 1:90187383-90187405 CACAGCTGTAGGTCTGGGCTTGG - Intergenic
911209849 1:95127550-95127572 CACAAAAGGAGCTCTTGGCTTGG - Intronic
917120117 1:171638341-171638363 CACACTTGGGAGGCTGGGCTGGG - Intronic
919801037 1:201354844-201354866 CTCACTTGCTTCTCTGGGCTTGG - Intergenic
920866302 1:209756696-209756718 CACACTGAGAGCTCTGGGCCAGG + Intronic
921089932 1:211832588-211832610 CACACTTTGATCTCTGATCTTGG - Intergenic
922786919 1:228287424-228287446 CACGCTTTGAGGTCTGGGCTAGG + Intronic
924401844 1:243691803-243691825 CACACTTAAATCTCTAGGCTAGG - Intronic
1062920191 10:1273617-1273639 CACGCTGAGAGCTCTGAGCTGGG + Intronic
1063677311 10:8152410-8152432 CACTACCGGAGCTCTGGGCTAGG - Intergenic
1064825330 10:19392345-19392367 AACACTTGGGGCTCAGGGTTGGG - Intronic
1070710937 10:78682725-78682747 CAATCCTGGAGCTGTGGGCTGGG - Intergenic
1070760987 10:79024355-79024377 CTCTCTTGGAGCTCTGAGCGCGG - Intergenic
1070889390 10:79930753-79930775 CACATCAGGAGCTCTGGGCAGGG - Intergenic
1071953278 10:90728975-90728997 CACACTTCTAGCTCTTGGCATGG + Intergenic
1074390029 10:113049434-113049456 CACACTTGGGCCTGTGGGATGGG - Intronic
1074454548 10:113586001-113586023 GACCCTTAGAGCCCTGGGCTGGG + Intronic
1074824771 10:117206774-117206796 CAAGCTTGGAGCTCAGGGCTCGG - Intronic
1075781475 10:125020247-125020269 CACACCTGGAACTCTGTGCATGG - Intronic
1076008057 10:126963980-126964002 CCCACTTGGAGCTGGAGGCTGGG - Intronic
1076252743 10:128996707-128996729 CAGACATGGAGCTCTGGCCCAGG - Intergenic
1077110062 11:858373-858395 CTCACTGGGAGCACTGGGCTTGG - Intronic
1077353638 11:2104768-2104790 CTCACTTGGGGCCCTGGGCTGGG - Intergenic
1077393735 11:2311230-2311252 CCCACTTTCAGCTCTGGGCCCGG - Intronic
1081252287 11:40850642-40850664 CAGACCTGGAGCACTGTGCTGGG + Intronic
1083503911 11:63137487-63137509 CACAATGGGATCTCTGGGCAAGG - Intronic
1084119956 11:67063094-67063116 CAAACATGGGGCACTGGGCTGGG + Intronic
1084288624 11:68147474-68147496 CACACTTGGGGCTGGGGGCCAGG + Intergenic
1084332276 11:68437178-68437200 CAGACTGTGAGCTGTGGGCTCGG + Intronic
1085389012 11:76172679-76172701 GGCATTTGGAGCCCTGGGCTGGG + Intergenic
1086124937 11:83340704-83340726 TACACTTGGAGCTCAGATCTTGG - Intergenic
1086873889 11:92072569-92072591 CACACTGGGAGCTGTAGACTGGG - Intergenic
1087225563 11:95594669-95594691 CACACTTGGGGCTCTTGGCTTGG + Intergenic
1088481137 11:110296937-110296959 CACACTCCGAGCTTTGGGCTGGG - Intergenic
1089311310 11:117559985-117560007 CACCCAAGGAGCTCTGGGCAGGG - Intronic
1089359130 11:117874807-117874829 AACACCTGGAGCTCCGGACTGGG + Intronic
1089878910 11:121754337-121754359 CATAGATGAAGCTCTGGGCTAGG - Intergenic
1091803386 12:3339318-3339340 CACACTTGGGTCCCTGTGCTGGG + Intergenic
1094263488 12:28527952-28527974 CAGACTTGGTGCTCTTGGCGGGG - Intronic
1099920649 12:88953241-88953263 CACAGTTTGACCTCTGGACTTGG + Intergenic
1101769693 12:107737719-107737741 CAGAGTTAGAGCTCTGGCCTTGG - Intronic
1101924872 12:108963171-108963193 CACCCTTGGAGCTCTGGGAAGGG - Intronic
1103001229 12:117386734-117386756 CACACTGGGTGTTCTGGGCTAGG - Intronic
1104000462 12:124856821-124856843 GTCACTGGGAGCCCTGGGCTAGG + Intronic
1104660684 12:130609743-130609765 CAGACCTGCAGCCCTGGGCTGGG - Intronic
1104755600 12:131267326-131267348 CACACTTCCAGGTCTGGGATGGG + Intergenic
1107088873 13:36454287-36454309 AACTTTTGTAGCTCTGGGCTGGG + Intergenic
1112496049 13:99905600-99905622 CACACCTGGAGCTCGGTTCTTGG - Intergenic
1112965315 13:105184105-105184127 CACACTCAGAGCTATGGCCTCGG - Intergenic
1113255871 13:108504420-108504442 CACTCCTAGAGATCTGGGCTGGG - Intergenic
1113608950 13:111629679-111629701 CAGGCTCCGAGCTCTGGGCTGGG + Intronic
1113750233 13:112771913-112771935 GACACCGGGAGCCCTGGGCTGGG + Intronic
1114555589 14:23560394-23560416 AACACTTTGAGATCTGGGATGGG + Exonic
1114888860 14:26890449-26890471 CGCACTTTGAGCTCTGCACTGGG - Intergenic
1114988753 14:28262519-28262541 CACACTGGGAGCTCTGTCCAGGG - Intergenic
1115305115 14:31925600-31925622 CTGACTTGTGGCTCTGGGCTGGG - Intergenic
1115549102 14:34489115-34489137 CACATTTCCAGCTCTAGGCTGGG - Intergenic
1115645748 14:35367460-35367482 CACACCAGGGGCTCTGTGCTGGG + Intergenic
1119624379 14:76159502-76159524 AGCACTGGGAGCACTGGGCTAGG - Intronic
1119927814 14:78513055-78513077 TACATTTGGATCTCTGGTCTGGG + Intronic
1121959951 14:98250096-98250118 GACACTTGGAAAGCTGGGCTTGG - Intergenic
1123181692 14:106477332-106477354 TACAATTGGAACTGTGGGCTTGG + Intergenic
1202903670 14_GL000194v1_random:56707-56729 CACAGTGGGAGCACAGGGCTGGG - Intergenic
1202945212 14_KI270726v1_random:19396-19418 TACAATTGGAACTGTGGGCTTGG - Intergenic
1126425619 15:48524229-48524251 CACAAAGGGAGCTCGGGGCTGGG + Intronic
1126546757 15:49882255-49882277 CACAACTGCTGCTCTGGGCTGGG - Intronic
1127643715 15:60939447-60939469 CTCACTTGCAACTCTGGGCCAGG + Intronic
1128460670 15:67864159-67864181 CAGACTTGGAGCTCTTGGGGTGG + Intergenic
1129356367 15:74994701-74994723 CCCACTTGGAGAGATGGGCTGGG - Intronic
1130149453 15:81300061-81300083 CACACCTGGGTCTCTGGCCTCGG - Exonic
1130998846 15:88921889-88921911 CACAATGGGATCTCTGGGCAAGG - Intergenic
1132640745 16:977287-977309 CACACTTGGAGCTCTGGGCTGGG - Intronic
1137969933 16:52975079-52975101 CAGAGCTGGAGCTCTGTGCTGGG + Intergenic
1138354679 16:56367712-56367734 CAAACTTGGAACTCTAGGTTAGG - Intronic
1138474167 16:57260858-57260880 CACACTTGAGGCCCTGGCCTGGG + Intronic
1141224035 16:82098387-82098409 CATTCTTAGAGCTCTGGGCATGG - Exonic
1142318940 16:89368513-89368535 CACAAAAGAAGCTCTGGGCTGGG - Intronic
1143181733 17:4987746-4987768 CACACGTGGAGTTCTGGGTGGGG + Intergenic
1143407475 17:6686973-6686995 CAGCTTTGCAGCTCTGGGCTGGG - Intronic
1144214729 17:13045237-13045259 AACACTTGGATGTGTGGGCTGGG + Intergenic
1146210117 17:30935753-30935775 CACACTTCTAGCTCAGGGCCAGG - Intronic
1146949089 17:36893367-36893389 TTCCCTGGGAGCTCTGGGCTGGG - Intergenic
1146949848 17:36898326-36898348 TTCCCTGGGAGCTCTGGGCTGGG + Intergenic
1148103373 17:45106256-45106278 AGCACGTGGAGCTCTTGGCTGGG + Exonic
1150930429 17:69578945-69578967 CACATCTGGAGCTGTGGCCTTGG + Intergenic
1152665754 17:81568307-81568329 CACTCTTGAAGCTCTGTGTTTGG - Intronic
1154177034 18:12092521-12092543 GGCACTTGGGGCTTTGGGCTTGG + Intergenic
1155031815 18:21991395-21991417 CTCAGTTGGGGCTCTGGGCTGGG + Intergenic
1156466486 18:37350902-37350924 CAGGCCTGGAGCTCTGGCCTGGG + Intronic
1158404671 18:57150875-57150897 CCCACTCAGATCTCTGGGCTGGG + Intergenic
1158466005 18:57690340-57690362 CACACTTGGGGCCCTGGGGTTGG + Intronic
1161652242 19:5492541-5492563 CCCACTCGCAGCCCTGGGCTCGG + Intergenic
1162374992 19:10299692-10299714 CACTCTTGGAGGTGGGGGCTAGG + Intergenic
1164180389 19:22813324-22813346 CACACTTGCATCTATGGACTGGG - Intergenic
1164333706 19:24285870-24285892 CACACTGGGAGCTGTAGACTGGG + Intergenic
1164467167 19:28497180-28497202 CACACTTTCAGCCCTGGGTTTGG - Intergenic
1164784420 19:30918772-30918794 TCCACTTGGAGCTCTAAGCTTGG + Intergenic
1164847738 19:31448900-31448922 CTCGCTTTGCGCTCTGGGCTGGG + Intergenic
1165655489 19:37528837-37528859 GTCCCTTGGAGCTCTGGCCTGGG + Intronic
1165962446 19:39546700-39546722 CACTCTTGTAGCTCTGAGATAGG + Intergenic
1166046328 19:40233040-40233062 CCCACTGGGGGCTATGGGCTGGG - Exonic
1168327552 19:55545967-55545989 CGCACTTGGGTCTCTGGGGTGGG + Intergenic
925983316 2:9194371-9194393 CACACTTGGACCTGTTGGGTGGG - Intergenic
927088862 2:19695159-19695181 CAGACCTGGAGCTGGGGGCTGGG + Intergenic
927149104 2:20185660-20185682 CAGACTTGGAGCTGTGGGGTGGG + Intergenic
927502039 2:23589424-23589446 CACCCTTGGAGCTGTGGCCTTGG + Intronic
928222736 2:29418316-29418338 AAAACTTGGACCTCGGGGCTAGG - Intronic
928410051 2:31047882-31047904 CACACCAGGAGCTGTGGGGTGGG + Intronic
929451501 2:42041027-42041049 CACGATTGCAGCGCTGGGCTTGG + Intergenic
934067106 2:88350574-88350596 CCCACTTGGAGGTCTGGGTGGGG + Intergenic
934209585 2:89963930-89963952 CTCACCTCGGGCTCTGGGCTTGG + Intergenic
934736929 2:96694252-96694274 TACCCATGGGGCTCTGGGCTCGG + Intergenic
936403842 2:112185365-112185387 CACACTTGGAGGCCTGGGTGAGG - Intronic
937047372 2:118858919-118858941 CACCCCAGGAGCTCAGGGCTGGG - Intergenic
938927657 2:136059195-136059217 CAGCCTTGAAGCTCAGGGCTTGG - Intergenic
940601817 2:155872881-155872903 CTCACTTGCAGCACTGGGTTTGG + Intergenic
940987363 2:160062601-160062623 GACACTCGGGGCTCTGGGCTGGG + Exonic
942738247 2:179141099-179141121 CAGACTTCGAAGTCTGGGCTGGG - Intronic
943036976 2:182759285-182759307 CAGAATTTGAGCTCTTGGCTAGG + Exonic
943378860 2:187117978-187118000 CATAATTTGAGATCTGGGCTAGG + Intergenic
944675206 2:202029690-202029712 GACTCTTGGAGCTCTGTCCTTGG - Intergenic
945067180 2:205957229-205957251 CACACCTGCAGGGCTGGGCTGGG - Intergenic
945080408 2:206082550-206082572 TACACATGCAGCTCTGTGCTAGG - Intronic
946621948 2:221571554-221571576 CACCCTCGGGGCGCTGGGCTTGG + Intronic
948301139 2:236908457-236908479 AGCTCTTGGAGCTCTGGGGTTGG + Intergenic
948685340 2:239666359-239666381 CAGACTTGGAGTCCTGGGTTTGG + Intergenic
1168844613 20:935354-935376 CAGTCTTGGGGCTCTGGCCTCGG + Intergenic
1168879469 20:1194370-1194392 CACACTGGGAGTGCTGGGTTAGG + Intergenic
1170875785 20:20248776-20248798 CACACCTGGAGCTTTGGACTAGG + Intronic
1171372503 20:24670646-24670668 CACCCTGGGAGCCCTGGGCACGG - Intergenic
1172656602 20:36541869-36541891 CCCCCCCGGAGCTCTGGGCTTGG - Intronic
1172889832 20:38256213-38256235 CACAGTTGGATCTCTGTGTTAGG - Intronic
1173788588 20:45812923-45812945 CACACCAGGAGCTCGGGGCCTGG + Intronic
1174090501 20:48043334-48043356 CACATTTCAAGCACTGGGCTTGG + Intergenic
1174997206 20:55583524-55583546 CCCACGTGGAGCTCTGTTCTAGG - Intergenic
1175188816 20:57197943-57197965 CACACTGGAAGCTCAGGGCCTGG + Intronic
1176291892 21:5050147-5050169 CACACCTGGGGCCCTGGGCAGGG - Intergenic
1176623033 21:9071476-9071498 CACAGTGGGAGCACAGGGCTGGG - Intergenic
1177376707 21:20279661-20279683 AACACTAGGAGCTCTGTGCAAGG + Intergenic
1177701448 21:24644644-24644666 CATAATTGGTGGTCTGGGCTGGG - Intergenic
1181921642 22:26325341-26325363 ATCATTTGGAGCTTTGGGCTGGG - Intronic
1183033853 22:35125976-35125998 CACAAATGCAGCTCTGGGTTGGG + Intergenic
1183934596 22:41255075-41255097 CACACCTAGAGCCCAGGGCTTGG + Intronic
1184206141 22:43004804-43004826 CTCCCTGGGCGCTCTGGGCTTGG + Intronic
1184415680 22:44350579-44350601 CAGACATGGGGCTCAGGGCTGGG + Intergenic
1184710220 22:46245316-46245338 CACACTTGGGGGGCTGGGCTGGG + Intronic
1184946325 22:47806937-47806959 CAGGCATGGAGCTCTGGGTTTGG - Intergenic
952899377 3:38099561-38099583 CTCCCTTGGAGCTCTGGGGGTGG - Intronic
953854566 3:46491198-46491220 CACACGTGGATATCTGGTCTAGG + Intergenic
954220906 3:49153349-49153371 CACACTGGCAGCTCTGAGGTTGG + Intergenic
964077337 3:152707419-152707441 CACAGTGGGAGATTTGGGCTGGG - Intergenic
967888137 3:194346962-194346984 CTGACTGGGAGCTCTGGCCTTGG + Intronic
968479808 4:828063-828085 CACACCTGGAGCTGGGGCCTGGG + Intergenic
969150231 4:5163087-5163109 CAGACTTGGAGGTCAGGGCCAGG + Intronic
969181539 4:5445948-5445970 GACACTTAGAGCTCTGTGCCTGG - Intronic
969598417 4:8161703-8161725 CACACTTGGAGCACGGCCCTTGG + Intergenic
969715636 4:8866933-8866955 GACACCTGGAGCCCAGGGCTGGG - Intronic
971357686 4:25909774-25909796 CAGACTTGAAGCTTGGGGCTTGG - Intronic
971621389 4:28857619-28857641 CACACTGGGAGCTGTAGACTGGG + Intergenic
975345990 4:73293180-73293202 CACACTGGGAGCTGTAGACTAGG + Intergenic
977578574 4:98700576-98700598 CTCCCTTGGAGCTCTGGGGCTGG + Intergenic
979119745 4:116883167-116883189 GAGGCTTGGAGGTCTGGGCTGGG - Intergenic
979698237 4:123638768-123638790 CAGACTTTGAGCACTGTGCTGGG + Intergenic
980127449 4:128787583-128787605 CTCAGTTGGTGCTCTTGGCTTGG + Intergenic
980995025 4:139771811-139771833 CAGATTTGGATCTCTGGGATGGG + Intronic
982187764 4:152819727-152819749 CACAAGTGCAGTTCTGGGCTTGG + Intronic
982201222 4:152962847-152962869 TACACTTGGTGCTCCAGGCTGGG + Exonic
985257870 4:188087405-188087427 CTCACCTGGAGATCAGGGCTTGG - Intergenic
988305117 5:29484602-29484624 TATACTTGGAGCTCTTGGCAAGG + Intergenic
991654170 5:68886380-68886402 CACACTGGGGCCTCTGGGGTGGG - Intergenic
992530955 5:77651144-77651166 CAAACCTGGAGCTAGGGGCTGGG + Intergenic
997611830 5:135220898-135220920 CCCACCTAGAACTCTGGGCTGGG + Intronic
997696212 5:135863046-135863068 CAGACCTGGGGCCCTGGGCTTGG + Intronic
998184599 5:139968634-139968656 CACACTGGGAGCTCTCCGTTCGG + Intronic
998315099 5:141175061-141175083 CATACTGGTAGCTCTGGGATAGG - Exonic
998319605 5:141216355-141216377 CATACTGGTAGCTCTGGGATAGG - Exonic
998322150 5:141242141-141242163 CATACTTGTACCTCTGGGATAGG - Intergenic
999370619 5:151052848-151052870 CAAACTTTGAGCTGGGGGCTGGG - Intronic
999452233 5:151686962-151686984 ACCACTCAGAGCTCTGGGCTGGG + Exonic
999547936 5:152651525-152651547 CACAGTTGGAGCTCTTGGTGGGG - Intergenic
1000559455 5:162767761-162767783 CTTACTTGGAGATGTGGGCTTGG - Intergenic
1000798323 5:165692923-165692945 CAGACCTGGAGCGCTGTGCTGGG + Intergenic
1001234690 5:170019727-170019749 CACACTGGGAGCTCTGGCAGTGG + Intronic
1002981348 6:2141828-2141850 CACACTGGGAAGTCTGGGTTTGG + Intronic
1004505450 6:16243429-16243451 CACATTCAGAGGTCTGGGCTGGG + Intronic
1005490004 6:26339054-26339076 CCCAGCTGGAGCTCTGTGCTTGG + Intergenic
1006392669 6:33767831-33767853 CACCCGTGGAGCTGAGGGCTTGG - Intergenic
1007507544 6:42347699-42347721 CACTCTTTGAGGTCAGGGCTTGG - Intronic
1016483443 6:144507777-144507799 CAGAGTTCGAGCTCTGTGCTGGG + Intronic
1017965113 6:159257507-159257529 CTCACTTCGAGCTCTTTGCTAGG - Intronic
1018221256 6:161582048-161582070 CATGCGTGGAGCTCTGGGCACGG - Intronic
1018771757 6:166976863-166976885 CCCACATGGGGCACTGGGCTGGG + Intergenic
1018801718 6:167227790-167227812 CACTCTTGGAGTTCTTGGTTAGG + Intergenic
1019179562 6:170177819-170177841 CTCAGCTGGAGCTCTGGCCTGGG + Intergenic
1019666478 7:2254499-2254521 AACACCTGGAGCCCTGGTCTGGG - Exonic
1021281810 7:18728903-18728925 CATACTAGGAGCTATGAGCTGGG + Intronic
1022042153 7:26591396-26591418 CAAACATGGAGCTCTGTACTTGG - Intergenic
1023525120 7:41094056-41094078 CAGAGCTGGAGCTCTGGACTTGG - Intergenic
1024545443 7:50513613-50513635 CAGACTTGGGGCTCTTGGCAGGG + Intronic
1026583893 7:71640357-71640379 CACACCAGGGGCTCTTGGCTTGG + Intronic
1027305864 7:76896463-76896485 CAGCCTTGGAGTTCTGGTCTTGG - Intergenic
1027340354 7:77201244-77201266 CAAACTTGGAGCACTTGGCTGGG + Intronic
1029814331 7:103077481-103077503 CACACTTGCCCCTCTGGCCTTGG - Intronic
1032781047 7:135165517-135165539 CACTCCTGGACCTCTGGGGTTGG - Exonic
1037766384 8:21774896-21774918 GGCAGATGGAGCTCTGGGCTTGG - Intronic
1037959316 8:23084271-23084293 CTCACTTGGAGCCCTGGGCTGGG + Intergenic
1037966082 8:23135078-23135100 CTCACTTGGAACCCTGGGCTGGG - Intergenic
1038084062 8:24174095-24174117 CACATATGAAGCTCTGGTCTTGG + Intergenic
1039796390 8:40919078-40919100 CACATCTGGAGCTGTGTGCTGGG - Intergenic
1040001476 8:42580304-42580326 CAGAGCTTGAGCTCTGGGCTGGG + Intergenic
1041189028 8:55334365-55334387 CATAATTGGAGCTTAGGGCTGGG + Intronic
1044317946 8:90771505-90771527 AAAACTTGGATCTCTGAGCTAGG - Intronic
1044473831 8:92603433-92603455 CACACTTAGAGCTCTGAGACTGG + Intergenic
1044638459 8:94352787-94352809 CCCACCTGTAGCTCTGGTCTGGG - Intergenic
1045269897 8:100652761-100652783 CACCCTTGGGCCTCTGGGATGGG + Intronic
1045327884 8:101130131-101130153 CATACTTGGGGCCCTGGGGTTGG - Intergenic
1045481645 8:102597462-102597484 CACATTTGAAGCTCTGGCCTTGG + Intergenic
1046339223 8:112829683-112829705 TACACTTGGAGCACTGTCCTAGG + Exonic
1047747054 8:127853125-127853147 CTCACTTGAAGCCCTGGCCTGGG - Intergenic
1047761600 8:127958690-127958712 CACACTTTGAGCCTTGGACTTGG - Intergenic
1048222116 8:132551696-132551718 CACACTTATACCTCTGGTCTGGG + Intergenic
1048848637 8:138623206-138623228 CATACTTGTAACTCTGGGATAGG - Intronic
1049497252 8:142942020-142942042 CACACTGTGAGCTCTGAGCTCGG - Intergenic
1049535149 8:143176571-143176593 GACACCTGGAGCTCTGGACCTGG - Intergenic
1049756234 8:144312361-144312383 CAACCTCGGAGCTCGGGGCTGGG + Intronic
1056418593 9:86401788-86401810 CACAATTAGAACTCTGGGCCGGG + Intergenic
1056876899 9:90342214-90342236 CCCACAGAGAGCTCTGGGCTAGG - Intergenic
1057306588 9:93916046-93916068 CACACTGTGAGCTGTGGGCAGGG - Intergenic
1057310227 9:93938370-93938392 CAGACTAGGGGTTCTGGGCTGGG + Intergenic
1058182574 9:101816145-101816167 CACAGTTTGAGCACTGTGCTGGG - Intergenic
1058525908 9:105857468-105857490 CAGACTTTCAGATCTGGGCTGGG + Intergenic
1059942032 9:119368498-119368520 TCCTCTTGGGGCTCTGGGCTTGG - Intronic
1060051885 9:120383726-120383748 GGCTCTGGGAGCTCTGGGCTTGG + Intergenic
1061112847 9:128587570-128587592 CACACATGGAGCACTGTGCAGGG - Intronic
1062475101 9:136722810-136722832 CACCCGTGTAGCTGTGGGCTGGG + Intronic
1062496759 9:136835585-136835607 AACTCATGGAGCTCTGCGCTGGG - Intronic
1203563882 Un_KI270744v1:77578-77600 CACAGTGGGAGCACAGGGCTGGG + Intergenic
1192781683 X:74299762-74299784 CACGCTTGCAGCTATGGGCCTGG - Intergenic
1194086926 X:89539306-89539328 CACACTGGGAGCAGTGCGCTGGG + Intergenic
1196428119 X:115592544-115592566 ATCAGTTGGAGCACTGGGCTAGG - Intronic
1198094521 X:133366199-133366221 AACATTTGGAGCTTTGGTCTTGG - Intronic
1199695119 X:150338519-150338541 AGCACTTGGATCTCTGGACTTGG + Intergenic
1200099853 X:153685013-153685035 CACCATAGGAGCTCTGGGCTGGG + Intronic
1200131683 X:153851948-153851970 CACACTCTCAGATCTGGGCTTGG - Intergenic
1200439583 Y:3195175-3195197 CACACTGGGAGCAGTGCGCTGGG + Intergenic
1201159550 Y:11156916-11156938 CACAGTGGGAGCACAGGGCTGGG - Intergenic
1202100214 Y:21299719-21299741 CTCACTTAGAGCTCTGGTATTGG + Intergenic