ID: 1132640746

View in Genome Browser
Species Human (GRCh38)
Location 16:977288-977310
Sequence GCACACTTGGAGCTCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 266}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640746_1132640753 4 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640753 16:977315-977337 CCAAGAAGCTGACTCCCGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1132640746_1132640756 16 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640746_1132640757 17 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640757 16:977328-977350 TCCCGAAGGGGGTCTTGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1132640746_1132640759 18 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640759 16:977329-977351 CCCGAAGGGGGTCTTGAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132640746_1132640751 3 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640751 16:977314-977336 GCCAAGAAGCTGACTCCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1132640746_1132640754 5 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640754 16:977316-977338 CAAGAAGCTGACTCCCGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98
1132640746_1132640755 6 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640755 16:977317-977339 AAGAAGCTGACTCCCGAAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640746 Original CRISPR GCACACTTGGAGCTCTGGGC TGG (reversed) Intronic
900312588 1:2041336-2041358 GCCCACTTGGGGCTGTGAGCCGG - Intergenic
901436333 1:9249368-9249390 AGACAGGTGGAGCTCTGGGCAGG + Intronic
901640526 1:10690844-10690866 GCACGGGTGGAGCTCTGAGCAGG - Intronic
902730118 1:18363647-18363669 GCACAGATGGAGCAATGGGCAGG + Intronic
903311958 1:22465707-22465729 GCACTCTTGGGGGTCTGGGAAGG - Intronic
904079342 1:27862371-27862393 GCACACCTGGAGCTCAAGACTGG + Intergenic
904376303 1:30084562-30084584 GCACACTGGGAAGTCGGGGCAGG - Intergenic
904404079 1:30274859-30274881 GCACCCTTGGAGGCCTGGGAAGG - Intergenic
905453426 1:38071526-38071548 GAGCACTTAGAGCTCTGGGGTGG - Intergenic
905457818 1:38100576-38100598 GCACAGTCTGAGCCCTGGGCTGG + Intergenic
905914296 1:41674412-41674434 GCACCCTGAGAGCTCTGGACAGG - Intronic
907310964 1:53538779-53538801 ACACACTGACAGCTCTGGGCTGG + Intronic
907343043 1:53750758-53750780 GGCCACTTGGAGATCTGGGTGGG - Intergenic
909103656 1:71381655-71381677 CCACAGTTGGAGGTCTGGCCTGG - Intergenic
910650892 1:89565785-89565807 GATCACTCTGAGCTCTGGGCAGG + Intronic
912463859 1:109855831-109855853 GCATACCTGGAGCTCTGTGAGGG + Intergenic
915603076 1:156934686-156934708 GCACAGCTGAAGCTCTGGGAGGG + Intergenic
915751220 1:158212795-158212817 GCACTCTTGGAGGCCTGGGAAGG + Intergenic
920298265 1:204973201-204973223 GGGCACTTGGGGCTCTGGCCAGG - Intronic
920890398 1:209979296-209979318 TCACACTGGGAGCTCTAGACTGG + Intronic
922514561 1:226197284-226197306 GCAAACCTGGGGCTCTGGGCAGG + Intergenic
922678808 1:227572684-227572706 GCACACTTGGGGCTCCGGAAAGG - Intronic
922719225 1:227891835-227891857 GGACACTTGGAGCCCTTGCCAGG - Intergenic
923086039 1:230704147-230704169 GCACACTTGGAACCCAGGTCAGG + Intronic
923842406 1:237687463-237687485 GCAAACTTGGAGTTCTTGTCAGG + Exonic
924299619 1:242624376-242624398 ACACACTGGGTTCTCTGGGCTGG + Intergenic
1062920190 10:1273616-1273638 GCACGCTGAGAGCTCTGAGCTGG + Intronic
1064825331 10:19392346-19392368 GAACACTTGGGGCTCAGGGTTGG - Intronic
1066168488 10:32815896-32815918 TCACACTGGGAGCTGTGGACTGG - Intronic
1069599030 10:69691502-69691524 GCACCCTTGGGGCTCTGAGTAGG - Intronic
1070889391 10:79930754-79930776 ACACATCAGGAGCTCTGGGCAGG - Intergenic
1071114257 10:82198750-82198772 GCACACTGGGAGGTCAGGGTGGG + Intronic
1071144966 10:82557990-82558012 GAACACGTGGAGCTCTAGGGAGG + Intronic
1072119809 10:92396431-92396453 CCACACTTGGAGAGATGGGCAGG + Intergenic
1072341865 10:94459775-94459797 CCACACTTGGAGCTGCTGGCCGG - Intronic
1073040282 10:100599480-100599502 ACTCACTTGGAACTCTGGACAGG - Intergenic
1074454547 10:113586000-113586022 GGACCCTTAGAGCCCTGGGCTGG + Intronic
1076501930 10:130943953-130943975 GCTCACCGGGAGCTCTGAGCAGG + Intergenic
1076719009 10:132384810-132384832 ACACACCTGGCGCTCTGGCCAGG + Intergenic
1077306055 11:1869127-1869149 GCCCACTTGGAGCCTGGGGCAGG - Intronic
1077353639 11:2104769-2104791 ACTCACTTGGGGCCCTGGGCTGG - Intergenic
1079472387 11:20790497-20790519 GCACTCTTGGAGACCTGGGAAGG - Intronic
1079865176 11:25724841-25724863 TCACACTGGGAGCTCTAGACTGG + Intergenic
1081252286 11:40850641-40850663 GCAGACCTGGAGCACTGTGCTGG + Intronic
1081345432 11:41979868-41979890 GCACACTGGGAGGCCTAGGCGGG + Intergenic
1081806116 11:45891521-45891543 GGAAACTTGCAGCTCTGGGGAGG + Intronic
1082158757 11:48859619-48859641 GGACACTTGGAGCGCTGTGAGGG + Intergenic
1083811225 11:65108057-65108079 GCACAGATGGGGCTCGGGGCTGG - Intronic
1084566102 11:69930070-69930092 GCACACTGGGGCCTCTGTGCAGG - Intergenic
1085521954 11:77144326-77144348 CCACCCTGGGGGCTCTGGGCAGG - Intronic
1087080198 11:94162809-94162831 TCACACTGGGAGCTCTAGACTGG + Intronic
1087625059 11:100586598-100586620 GCACTTTTGGAGATCTGGGTGGG - Intergenic
1088481138 11:110296938-110296960 GCACACTCCGAGCTTTGGGCTGG - Intergenic
1089257198 11:117200238-117200260 GCACACCTGGACCTCTGAGAGGG - Intronic
1089311311 11:117559986-117560008 TCACCCAAGGAGCTCTGGGCAGG - Intronic
1089360553 11:117883314-117883336 GCCCAAGTGGAGCGCTGGGCAGG + Intergenic
1089501600 11:118935002-118935024 GCACTCTGGGAGCCCTAGGCAGG + Intronic
1090504915 11:127300732-127300754 GTACACTGGGAGCTCTGAGGAGG - Intergenic
1090805269 11:130198513-130198535 GAACACCTGAAGGTCTGGGCCGG - Exonic
1091670352 12:2447882-2447904 GCCCACTTGGGGCTGTGGACAGG + Intronic
1092457469 12:8656912-8656934 GCACACTGGGAGGCCTAGGCGGG - Intronic
1093620557 12:21284287-21284309 TCACACTGGGAGCTGTGGACCGG - Intronic
1094263489 12:28527953-28527975 ACAGACTTGGTGCTCTTGGCGGG - Intronic
1097269670 12:57766217-57766239 GGACACTTGGATACCTGGGCGGG + Intronic
1100014772 12:89996036-89996058 GCACACATGGTGCTGTGGGAGGG - Intergenic
1101924873 12:108963172-108963194 TCACCCTTGGAGCTCTGGGAAGG - Intronic
1102344659 12:112151949-112151971 GCACACAAGGAGAGCTGGGCTGG - Exonic
1103433759 12:120908520-120908542 GCACACTGGGAGGCCTAGGCGGG + Intergenic
1104987626 12:132605913-132605935 GCACACTTGAGGCTATGGGACGG - Intronic
1105018203 12:132798933-132798955 GAGCACCTGGAGGTCTGGGCCGG - Intronic
1106407227 13:29484536-29484558 GCAGACTGGGAGCTCTGGCATGG + Intronic
1107088872 13:36454286-36454308 GAACTTTTGTAGCTCTGGGCTGG + Intergenic
1110557337 13:76875310-76875332 GAACACATGGAGTTCTGGGCAGG + Intergenic
1110818474 13:79887062-79887084 TCACACTGGGAGCTGTGGACCGG - Intergenic
1112068876 13:95825703-95825725 GCAGACTTGGTGCTCTTGGAGGG - Intronic
1113608949 13:111629678-111629700 GCAGGCTCCGAGCTCTGGGCTGG + Intronic
1113627851 13:111859519-111859541 CCACACTTGGTGCTCTTCGCCGG - Intergenic
1114264013 14:21060604-21060626 GGACTTTGGGAGCTCTGGGCTGG - Intronic
1114988754 14:28262520-28262542 TCACACTGGGAGCTCTGTCCAGG - Intergenic
1116011763 14:39359643-39359665 TCACACTGGGAGCTCTAGGCTGG + Intronic
1121007119 14:90497558-90497580 GCACATTGGGAGGTCTAGGCAGG + Intergenic
1121107248 14:91289143-91289165 GCACAGTTGGAGCCCAGTGCGGG + Exonic
1122601259 14:102923042-102923064 GCACACTCGCTGCTCTCGGCAGG - Intronic
1124349826 15:28947141-28947163 GCGCACTTGCAGCTCTTGGGAGG + Intronic
1125342387 15:38687737-38687759 GCACAGCTGGAGTTCTGGGAGGG + Intergenic
1125749384 15:42018549-42018571 GAAGACTTGGAGCTCAAGGCAGG + Intronic
1127074232 15:55310330-55310352 GCACACCTGGGGCTCTGTGAGGG + Intronic
1127085383 15:55419748-55419770 GCACATTGGGAGCCCGGGGCTGG + Intronic
1128373562 15:67059233-67059255 GGGCACTTGGAGCCCAGGGCAGG - Intergenic
1128978166 15:72168102-72168124 GCAGGCTTGGAGATCAGGGCAGG - Intronic
1129365061 15:75049068-75049090 GAGCACTTGGAGCAATGGGCAGG + Intronic
1131425086 15:92339432-92339454 GCACACAAGGAGCACAGGGCTGG + Intergenic
1132600679 16:771259-771281 GCACTCTGGGAGGCCTGGGCAGG + Intronic
1132640746 16:977288-977310 GCACACTTGGAGCTCTGGGCTGG - Intronic
1132680837 16:1141126-1141148 GGACCCTTGGACCTGTGGGCAGG + Intergenic
1132898047 16:2238169-2238191 CCCCATGTGGAGCTCTGGGCAGG + Intronic
1133039474 16:3052720-3052742 GCACAAGTGCAGGTCTGGGCGGG + Intronic
1136778376 16:32883300-32883322 GCACACTTGGCTCTCTAGGTAGG - Intergenic
1136892244 16:33978214-33978236 GCACACTTGGCTCTCTAGGTAGG + Intergenic
1137035056 16:35563022-35563044 TTACAATTTGAGCTCTGGGCAGG + Intergenic
1137937078 16:52645022-52645044 GCAAACTTGGAGTTCCTGGCAGG + Intergenic
1138474166 16:57260857-57260879 GCACACTTGAGGCCCTGGCCTGG + Intronic
1139667853 16:68470882-68470904 GAACACTTGCAGCTCTTGTCAGG - Intergenic
1139686863 16:68610717-68610739 GCACACTGGGAGCACTTGGGAGG + Intergenic
1141501618 16:84448706-84448728 GCAAGCTTAAAGCTCTGGGCCGG - Intronic
1142007109 16:87694584-87694606 GCACCATGGGAGCTATGGGCTGG - Intronic
1142140553 16:88470903-88470925 GCACAGTGGGAGCTCCGAGCAGG + Intronic
1142210657 16:88806926-88806948 GCACACTGGGTGGTCTGTGCCGG - Intronic
1142318941 16:89368514-89368536 GCACAAAAGAAGCTCTGGGCTGG - Intronic
1203080798 16_KI270728v1_random:1145409-1145431 GCACACTTGGCTCTCTAGGTAGG - Intergenic
1143181732 17:4987745-4987767 GCACACGTGGAGTTCTGGGTGGG + Intergenic
1143407476 17:6686974-6686996 GCAGCTTTGCAGCTCTGGGCTGG - Intronic
1144174601 17:12693019-12693041 CCACGCTTGTAGCTCGGGGCTGG - Intronic
1144214728 17:13045236-13045258 GAACACTTGGATGTGTGGGCTGG + Intergenic
1145969801 17:28950274-28950296 GCACACTCGGAGCTCCCGGGCGG + Intronic
1146160066 17:30554935-30554957 GCACCCTGGGTGCACTGGGCAGG + Intergenic
1147661734 17:42120671-42120693 GCGCCCTTGGAGCTGGGGGCAGG - Intronic
1148621682 17:49039336-49039358 GCAGCTTTGGAGCTGTGGGCTGG + Intronic
1149321573 17:55487154-55487176 GAACACTTGGACCACAGGGCGGG + Intergenic
1151198038 17:72445753-72445775 GCACACCTGGACGTCGGGGCAGG + Intergenic
1151793637 17:76327099-76327121 GCACACTGGGAGGTCGAGGCAGG + Intronic
1152698286 17:81806916-81806938 GGAGACCTGGGGCTCTGGGCAGG - Intronic
1155031814 18:21991394-21991416 CCTCAGTTGGGGCTCTGGGCTGG + Intergenic
1156466485 18:37350901-37350923 GCAGGCCTGGAGCTCTGGCCTGG + Intronic
1159475449 18:68915164-68915186 TCACGCTTGAAGCTCTGTGCTGG + Intronic
1161591225 19:5129973-5129995 GCTCACATGGAGCTGTGTGCAGG + Intronic
1161942797 19:7416149-7416171 GCACACTGGGAGGCCTAGGCAGG + Intronic
1163279001 19:16303698-16303720 GCACTTTGGGAGCTCTAGGCAGG - Intergenic
1163680240 19:18677288-18677310 GCACACAGGGAACTCTGGCCTGG + Intergenic
1163807039 19:19405788-19405810 GCACACATGGAGCCCGGCGCCGG - Intronic
1165255218 19:34573579-34573601 GCACACATGGACCTGCGGGCTGG - Intergenic
1165778145 19:38417015-38417037 GACCACTTGGAGCTTTGGGGAGG + Intronic
1165800319 19:38545564-38545586 GCACTCTGGGAGCCCTAGGCGGG + Intronic
1168361545 19:55745028-55745050 GCACACTGGGAGGTCGAGGCGGG + Intergenic
925918869 2:8625825-8625847 TCACACGTGGACATCTGGGCAGG - Intergenic
927149103 2:20185659-20185681 ACAGACTTGGAGCTGTGGGGTGG + Intergenic
927767088 2:25820918-25820940 GCACACTGGGAGGCCTAGGCGGG + Intronic
928818332 2:35325844-35325866 TCACACTGGGAGCTCTAGACTGG + Intergenic
928879954 2:36086865-36086887 GTACACATGGAGGTCTGGCCTGG - Intergenic
930424400 2:51194466-51194488 GCAGACTTGGTGCTGTTGGCTGG + Intergenic
931177177 2:59865718-59865740 GCACATGAGGAACTCTGGGCAGG + Intergenic
931367151 2:61628942-61628964 GCACACTGGGAGGTCGAGGCGGG - Intergenic
932469623 2:71945308-71945330 CCAGACTTGCAGCGCTGGGCGGG - Intergenic
934067104 2:88350573-88350595 CCCCACTTGGAGGTCTGGGTGGG + Intergenic
937972840 2:127564042-127564064 CCACCTTGGGAGCTCTGGGCTGG + Intronic
939635985 2:144583069-144583091 GCATGCTAGGAGCTCTGTGCAGG - Intergenic
940987362 2:160062600-160062622 CGACACTCGGGGCTCTGGGCTGG + Exonic
941164730 2:162073349-162073371 GGACAGTTGGAGCTCAGGTCAGG - Intronic
945649308 2:212538775-212538797 GTGCGCTTGGCGCTCTGGGCCGG + Exonic
945870383 2:215220279-215220301 TCACACTGGGAGCTGTGGACCGG - Intergenic
947134405 2:226962953-226962975 GCACTATTGGAACTTTGGGCTGG + Intronic
948235863 2:236389632-236389654 TCACACTGGGAGCTGTAGGCCGG + Intronic
948892546 2:240914550-240914572 GCACTGTTGGAGCTCAGGGAAGG + Intergenic
1170362652 20:15563715-15563737 GCACACTTCTAGCTCTTTGCTGG + Intronic
1175641960 20:60637956-60637978 GCACACTGGGAGGCCTAGGCAGG + Intergenic
1175786928 20:61717823-61717845 GCACACTGGGGGCTGGGGGCGGG - Exonic
1176078448 20:63259825-63259847 TCCCAGTGGGAGCTCTGGGCGGG + Intronic
1176291893 21:5050148-5050170 CCACACCTGGGGCCCTGGGCAGG - Intergenic
1179576306 21:42310515-42310537 GCACAGTGGGAAGTCTGGGCCGG + Intergenic
1182697977 22:32209105-32209127 GCCCACCTGGAGCTGTGAGCTGG + Intergenic
1184406622 22:44304213-44304235 GCAGAGTTAGGGCTCTGGGCAGG + Intronic
1184710219 22:46245315-46245337 CCACACTTGGGGGGCTGGGCTGG + Intronic
1184924826 22:47629768-47629790 GGTCACTTGGAGAGCTGGGCGGG - Intergenic
1184927885 22:47657036-47657058 GCAAACTCGGGGCACTGGGCGGG - Intergenic
956926082 3:73990745-73990767 TCACACTGGGAGCTGTGGACCGG - Intergenic
957000221 3:74876017-74876039 GCATACTTGGGGCTCTGTGAGGG + Intergenic
958966963 3:100569872-100569894 GCACTCTTGGAGTTCAGGGGAGG + Intronic
962961484 3:140315154-140315176 GCAGATTTGGAGCTCTGAGCAGG - Intronic
964077338 3:152707420-152707442 GCACAGTGGGAGATTTGGGCTGG - Intergenic
964409980 3:156387797-156387819 GCACTCTTGGAGATGTGTGCAGG + Intronic
964974154 3:162599781-162599803 CCACACTTGGAGCTGCTGGCCGG + Intergenic
966844155 3:184113828-184113850 GCACACTGGGAGACCAGGGCCGG + Intergenic
968479807 4:828062-828084 GCACACCTGGAGCTGGGGCCTGG + Intergenic
968482958 4:844891-844913 GCACACCTGGGGCTGGGGGCAGG + Intergenic
968492779 4:899347-899369 GCCCTCTTGGAGCCCTGTGCTGG - Intronic
968624032 4:1618526-1618548 GCCCACCTGGAGGTGTGGGCTGG + Intronic
969715637 4:8866934-8866956 GGACACCTGGAGCCCAGGGCTGG - Intronic
971331967 4:25689048-25689070 GCACCCTTGGAGAGCTGGGTAGG + Intergenic
971397430 4:26241756-26241778 GCACTTTGGGAGGTCTGGGCGGG - Intronic
975173403 4:71259319-71259341 ACACATTTGGAGCTCTGAGGAGG + Intronic
976334301 4:83867889-83867911 GCACAGTTGGAGGTATGGGGAGG + Intergenic
979119746 4:116883168-116883190 GGAGGCTTGGAGGTCTGGGCTGG - Intergenic
979444991 4:120802302-120802324 TCACACTGGGAGCTGTGGACTGG - Intronic
979698236 4:123638767-123638789 GCAGACTTTGAGCACTGTGCTGG + Intergenic
983547750 4:168980267-168980289 GCTCACTTGGAGCACTGAGAAGG + Intronic
984102219 4:175499743-175499765 GCACCCTTGGGGGCCTGGGCAGG - Intergenic
985537460 5:473211-473233 GCACTCTCGGAGTTCTGCGCAGG + Intergenic
985691789 5:1317124-1317146 GCAGGCTTGGGGCTCTGAGCAGG + Intergenic
985905635 5:2833711-2833733 GCAGACTGGGCGCTCCGGGCAGG + Intergenic
986773688 5:10995100-10995122 GCAAACTGGGATCTCAGGGCTGG + Intronic
989862219 5:46391298-46391320 GGACACTTGGAGCGCTTGGAGGG + Intergenic
989863050 5:46407347-46407369 GTACATTTGGAGCTCTTTGCGGG + Intergenic
990083907 5:51951779-51951801 TCACACTGGGAGCTGTGGACTGG - Intergenic
992338775 5:75800275-75800297 TCACACTGGGAGCTGTAGGCTGG + Intergenic
992530954 5:77651143-77651165 GCAAACCTGGAGCTAGGGGCTGG + Intergenic
997611828 5:135220897-135220919 GCCCACCTAGAACTCTGGGCTGG + Intronic
998645424 5:144056005-144056027 TCACACTGGGAGCTCTAGACTGG + Intergenic
998899568 5:146838539-146838561 GCTCACTTTGTCCTCTGGGCAGG - Intronic
999547937 5:152651526-152651548 TCACAGTTGGAGCTCTTGGTGGG - Intergenic
1000425089 5:161080891-161080913 GCACTTTTGGAGGTCTAGGCGGG - Intergenic
1000456299 5:161453788-161453810 GCACACTGGGAGGTCGGGGTGGG + Intronic
1000798322 5:165692922-165692944 GCAGACCTGGAGCGCTGTGCTGG + Intergenic
1005105919 6:22223918-22223940 GCACACTTGGAGCTCAAGCAGGG - Intergenic
1005959015 6:30683449-30683471 GCACAGTGGGAGTTCTGGACAGG - Intronic
1005997291 6:30939231-30939253 GCACAATTGGTGTCCTGGGCTGG + Intergenic
1006825776 6:36934742-36934764 GCACTTTGGGAGGTCTGGGCGGG + Intergenic
1007730473 6:43942479-43942501 GAACCCTGGGAGCTCTGGACCGG + Intergenic
1007769592 6:44182435-44182457 GCACACAAAGAGCGCTGGGCAGG + Intronic
1009361440 6:62818866-62818888 TCACGCTGGGAGCTCTAGGCTGG + Intergenic
1014012521 6:116492770-116492792 ACACACTTGGAGCCCAGGGGAGG + Intergenic
1016483442 6:144507776-144507798 GCAGAGTTCGAGCTCTGTGCTGG + Intronic
1018499003 6:164382596-164382618 GCAAACTTGGAGCTGTGGTTGGG - Intergenic
1019157939 6:170051533-170051555 GCACAGTGGACGCTCTGGGCTGG + Intergenic
1019337514 7:492324-492346 GCAAGCTTGGAGGTCTGGACGGG + Intergenic
1019750574 7:2726584-2726606 GCACACTGTGTGCTCAGGGCAGG + Intronic
1022289483 7:28987211-28987233 GGACAGCTGGAGCTATGGGCAGG + Intergenic
1023511144 7:40954543-40954565 TCACACTGGGAGCTGTGGACTGG + Intergenic
1023795690 7:43790106-43790128 GCTCAGCTGGAGCTCTGAGCGGG + Intronic
1024545442 7:50513612-50513634 ACAGACTTGGGGCTCTTGGCAGG + Intronic
1025750753 7:64292041-64292063 TCACAATTTGAACTCTGGGCAGG + Intergenic
1025750863 7:64293038-64293060 TCACAATTTGAACTCTGGGCAGG + Intergenic
1025785382 7:64639143-64639165 GCACATTTTGAACTGTGGGCCGG - Intergenic
1026618182 7:71926196-71926218 GGACACATGGAGCTGTGTGCAGG - Intronic
1027340353 7:77201243-77201265 GCAAACTTGGAGCACTTGGCTGG + Intronic
1028912290 7:96222315-96222337 CCACACTGGGAGGCCTGGGCTGG - Intronic
1029444607 7:100605082-100605104 GCAAAATTGGTGCTCTGGGGAGG - Exonic
1032187848 7:129742770-129742792 GCACACTGGAAGCTCTGGAAAGG + Intronic
1033122193 7:138676080-138676102 GCACACTGGGAGGTCAAGGCCGG - Intronic
1037925435 8:22840486-22840508 GCACACTGGGAGGTCGAGGCAGG - Intronic
1037953423 8:23034478-23034500 GCACATTGGGAGGTCAGGGCAGG + Intronic
1037959315 8:23084270-23084292 CCTCACTTGGAGCCCTGGGCTGG + Intergenic
1037966083 8:23135079-23135101 CCTCACTTGGAACCCTGGGCTGG - Intergenic
1038593562 8:28864094-28864116 GCACACTGGGAGGTCAAGGCAGG + Intronic
1039334825 8:36577321-36577343 ACACATTTGGTGCTCTGGCCAGG - Intergenic
1040001475 8:42580303-42580325 GCAGAGCTTGAGCTCTGGGCTGG + Intergenic
1042129293 8:65571195-65571217 GCACTTTGGGAGGTCTGGGCGGG - Intergenic
1042737297 8:72003844-72003866 GCAGACCTGGAGCTCAGAGCTGG + Intronic
1044638461 8:94352788-94352810 GCCCACCTGTAGCTCTGGTCTGG - Intergenic
1048798577 8:138174372-138174394 GCACACCTGGAGGTCAGAGCTGG - Intronic
1049122920 8:140756076-140756098 GCACACTGGGAGGCCGGGGCAGG + Intronic
1049708676 8:144054101-144054123 GCACAGTGGGAGCTCAGCGCAGG + Intronic
1049998316 9:1051485-1051507 GCAGACCAGGAGCTTTGGGCCGG + Intronic
1052911085 9:33882527-33882549 GCACTTTTGGAGCCCTAGGCGGG - Intronic
1054760477 9:69000077-69000099 GCACACTTGGACCTGAGGGAAGG - Intronic
1055829133 9:80359420-80359442 GCAAGCTTGGAGAGCTGGGCGGG + Intergenic
1056418592 9:86401787-86401809 TCACAATTAGAACTCTGGGCCGG + Intergenic
1056576356 9:87858408-87858430 GCAAACCTGGAGAGCTGGGCAGG + Intergenic
1056762037 9:89422553-89422575 GCACGCATGGTGCTCGGGGCAGG - Intronic
1057306589 9:93916047-93916069 TCACACTGTGAGCTGTGGGCAGG - Intergenic
1057436089 9:95041931-95041953 GCACACTTAGGGATCTGGGAGGG + Intronic
1057548485 9:96035147-96035169 TCCCACTTGGAGATCTGAGCAGG - Intergenic
1057581264 9:96289717-96289739 GAACACTTGGTTGTCTGGGCTGG + Intronic
1057638793 9:96797038-96797060 TCACACTGGGAGCTGTGGACCGG - Intergenic
1058182575 9:101816146-101816168 GCACAGTTTGAGCACTGTGCTGG - Intergenic
1059061653 9:111039287-111039309 GCACACCTGGAGGTGTGGGTGGG + Intergenic
1059822123 9:117984840-117984862 CCAGACTTGGAGCCCTGGGGTGG + Intergenic
1060407544 9:123380358-123380380 GCTGGCCTGGAGCTCTGGGCAGG + Exonic
1061112848 9:128587571-128587593 CCACACATGGAGCACTGTGCAGG - Intronic
1061757662 9:132826682-132826704 GCACACATGCATTTCTGGGCAGG + Intronic
1186743015 X:12537910-12537932 TCACACTGGGAGCTGTAGGCTGG - Intronic
1187584659 X:20646849-20646871 ACACACTGGGACCTCTAGGCAGG + Intergenic
1189335281 X:40167404-40167426 GCACACGTGGAGTTCCGCGCAGG - Intronic
1190203585 X:48383976-48383998 GGACCTTTGGTGCTCTGGGCGGG - Intronic
1190206951 X:48411428-48411450 GGACCTTTGGTGCTCTGGGCGGG + Intronic
1191573579 X:62665703-62665725 GAACACTTTGAGGTCTGGGGTGG + Intergenic
1191610116 X:63102949-63102971 TCACACTGGGAGCTGTAGGCTGG - Intergenic
1194086925 X:89539305-89539327 GCACACTGGGAGCAGTGCGCTGG + Intergenic
1195381295 X:104273488-104273510 GCACTTTTGGAGGTCTAGGCGGG - Intergenic
1195535014 X:106000916-106000938 GCATACTTGGGGCTCTGTGAGGG - Intergenic
1200099852 X:153685012-153685034 CCACCATAGGAGCTCTGGGCTGG + Intronic
1200439582 Y:3195174-3195196 GCACACTGGGAGCAGTGCGCTGG + Intergenic
1201645361 Y:16223946-16223968 TCACACTGGGAGCTGTGGACCGG + Intergenic
1201657452 Y:16361376-16361398 TCACACTGGGAGCTGTGGACCGG - Intergenic
1201956978 Y:19634950-19634972 CCACACTGGGAGCTCTAGCCTGG + Intergenic
1202333361 Y:23778569-23778591 TCACACTTGGAGCTGTAGACTGG + Intergenic
1202537408 Y:25891494-25891516 TCACACTTGGAGCTGTAGACTGG - Intergenic