ID: 1132640747

View in Genome Browser
Species Human (GRCh38)
Location 16:977292-977314
Sequence CCACGCACACTTGGAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640747_1132640759 14 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640759 16:977329-977351 CCCGAAGGGGGTCTTGAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132640747_1132640756 12 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640747_1132640753 0 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640753 16:977315-977337 CCAAGAAGCTGACTCCCGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1132640747_1132640755 2 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640755 16:977317-977339 AAGAAGCTGACTCCCGAAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1132640747_1132640757 13 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640757 16:977328-977350 TCCCGAAGGGGGTCTTGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1132640747_1132640751 -1 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640751 16:977314-977336 GCCAAGAAGCTGACTCCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1132640747_1132640754 1 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640754 16:977316-977338 CAAGAAGCTGACTCCCGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640747 Original CRISPR CCACGCACACTTGGAGCTCT GGG (reversed) Intronic
900477203 1:2881609-2881631 CCTGGGACACCTGGAGCTCTCGG - Intergenic
900819832 1:4878200-4878222 CCATTCACTCTTGCAGCTCTGGG - Intergenic
902765669 1:18613204-18613226 CCAGGCAGGGTTGGAGCTCTGGG - Intergenic
906228870 1:44143378-44143400 CCACTTTCACTTGGAGGTCTGGG + Intergenic
909440983 1:75696068-75696090 CCACCAACATTTGGAGTTCTTGG - Intergenic
915469406 1:156116480-156116502 CCAAGCACCCTTAGTGCTCTTGG - Intronic
916094600 1:161337815-161337837 CCAAACACACTTGGGGCTCTGGG - Intronic
920311329 1:205050266-205050288 ACACACACACTCAGAGCTCTAGG - Intronic
923074735 1:230600291-230600313 CCACGCACACTTGTGGTTCAGGG - Intergenic
1062906019 10:1180212-1180234 CCAGGCACACCTGGGGCTGTGGG + Exonic
1062906064 10:1180341-1180363 CCAGGCACACCTGGGGCTGTGGG + Exonic
1062906094 10:1180427-1180449 CCAGGCACACCTGGGGCTGTGGG + Exonic
1064298968 10:14104780-14104802 CCACACACAGTGAGAGCTCTAGG - Intronic
1067270896 10:44790478-44790500 CCACACACACATGGATTTCTGGG + Intergenic
1067415598 10:46099281-46099303 ATACTCACTCTTGGAGCTCTGGG - Intergenic
1069439242 10:68412804-68412826 CAAACCAGACTTGGAGCTCTGGG + Intergenic
1070531840 10:77343711-77343733 CCACGGACACTATGACCTCTTGG - Intronic
1075810766 10:125223009-125223031 TCACGCACCCTTTTAGCTCTTGG - Intergenic
1077659976 11:4059181-4059203 CCAGGAACACTTCTAGCTCTTGG - Intronic
1079251562 11:18791369-18791391 CCACGCCCCCGTGGGGCTCTGGG - Intronic
1079604136 11:22343819-22343841 CCCCGCCCAGTTGGTGCTCTGGG + Intronic
1083259665 11:61516249-61516271 CCACGTGCAGGTGGAGCTCTGGG - Intronic
1084028789 11:66468543-66468565 CCACACACACTAGGTGCTTTAGG - Intronic
1085524440 11:77156132-77156154 GAGCGCACAGTTGGAGCTCTAGG - Intronic
1087893651 11:103563752-103563774 CCAGGCTCATTTGGAGCTCCTGG - Intergenic
1088995527 11:114993106-114993128 CCAGGGACAGATGGAGCTCTAGG - Intergenic
1090619344 11:128547875-128547897 CCACTCACACTGGCAGCTTTGGG + Intronic
1091841501 12:3624625-3624647 CAGCACACACTAGGAGCTCTGGG - Intronic
1100211912 12:92406831-92406853 CCACGCCCACCTGGAACTCCAGG + Intergenic
1101924874 12:108963176-108963198 GAACTCACCCTTGGAGCTCTGGG - Intronic
1104765680 12:131328448-131328470 CCACGCCCACCTGCATCTCTGGG - Intergenic
1104813591 12:131633412-131633434 CCACGCCCACCTGCATCTCTGGG + Intergenic
1104813628 12:131633544-131633566 CCACGCCCACCTGCATCTCTGGG + Intergenic
1104813644 12:131633609-131633631 CCACGCCCACCTGCATCTCTGGG + Intergenic
1104987627 12:132605917-132605939 CCAAGCACACTTGAGGCTATGGG - Intronic
1105255508 13:18741862-18741884 CCACGCAGTCTTGGGTCTCTTGG + Intergenic
1105925292 13:25002357-25002379 CCACCCACACTTGTAACTCTGGG + Intergenic
1107425960 13:40293030-40293052 CCACGTACATTTGGGGCTTTAGG + Intergenic
1110318495 13:74135260-74135282 GCACGCAAACTTGGAGGACTGGG + Intergenic
1111644075 13:91008007-91008029 CCAAACACACTTGAACCTCTGGG - Intergenic
1112068878 13:95825707-95825729 TCAGGCAGACTTGGTGCTCTTGG - Intronic
1116011762 14:39359639-39359661 TCGCTCACACTGGGAGCTCTAGG + Intronic
1116208581 14:41904578-41904600 CCACTCACACTTGAAGCAATGGG - Intergenic
1117153103 14:52909292-52909314 CCACGTATGCCTGGAGCTCTAGG + Intronic
1118347655 14:64951542-64951564 CCACCCACACTCCCAGCTCTGGG - Intronic
1121081643 14:91113567-91113589 CCACCCACATTTAGAGGTCTTGG - Intronic
1123061821 14:105597963-105597985 CCACGCACACGTCCAGCTCTGGG + Intergenic
1123086559 14:105719694-105719716 CCACGCACACGTCCAGCTCTGGG + Intergenic
1126972125 15:54127686-54127708 ACACACACACTTGAAGTTCTGGG - Intronic
1129658777 15:77541718-77541740 CCACACACACTTGGGACTCCTGG + Intergenic
1129737652 15:77975031-77975053 CCACGCAGACTTGCAGGGCTGGG - Intergenic
1132149021 15:99446801-99446823 ACACGCACACAGGGAGCACTGGG + Intergenic
1132640747 16:977292-977314 CCACGCACACTTGGAGCTCTGGG - Intronic
1133555346 16:6901431-6901453 CCAGGCACCCTTTGACCTCTTGG - Intronic
1136778378 16:32883304-32883326 CCCAGCACACTTGGCTCTCTAGG - Intergenic
1136892242 16:33978210-33978232 CCCAGCACACTTGGCTCTCTAGG + Intergenic
1141876149 16:86825932-86825954 CCACACACACTGAGAGCTCAGGG + Intergenic
1203080800 16_KI270728v1_random:1145413-1145435 CCCAGCACACTTGGCTCTCTAGG - Intergenic
1147153725 17:38532861-38532883 CCACGGAGACTTGGAGCAGTGGG - Exonic
1147958945 17:44154481-44154503 CCTGGCACACTTGGAGACCTGGG + Intronic
1150069492 17:62139276-62139298 CCTCGTACACCTGGCGCTCTAGG + Intergenic
1152065865 17:78112278-78112300 CCCCGCAGACCTGGAGCCCTGGG + Exonic
1154435514 18:14338742-14338764 CCAAGCAGGCTTGGATCTCTTGG - Intergenic
1157792136 18:50542093-50542115 CAACACACACTTGATGCTCTGGG + Intergenic
1158718498 18:59900897-59900919 CCACACAGACTTCGGGCTCTGGG - Intronic
1160017862 18:75158040-75158062 CCACGCGGATTTGGAGCTCATGG - Intergenic
1161474589 19:4477218-4477240 CCACGCACACGTGCCGCACTGGG + Intronic
1161553753 19:4928922-4928944 CCACGCACACATGGGGGTCTTGG - Intronic
1161664418 19:5566076-5566098 ACACTCACACTTGGATATCTGGG - Intergenic
1162344913 19:10113399-10113421 CCAGGCAGTCTTGGAGCTCAAGG - Intronic
1168195652 19:54771940-54771962 ACACGCCCACCAGGAGCTCTGGG - Intronic
1168683671 19:58335108-58335130 CCACCCAGGCTTGGATCTCTGGG - Exonic
925409220 2:3629336-3629358 CCACACACACTGGGACCTATTGG - Intronic
925600459 2:5603783-5603805 CCACTCACTCTTGCTGCTCTTGG + Intergenic
925983319 2:9194376-9194398 CAACACACACTTGGACCTGTTGG - Intergenic
927962243 2:27248281-27248303 CCTCACACACTTGGAATTCTGGG - Intergenic
929248824 2:39730838-39730860 CCACTCTCACTTTCAGCTCTTGG + Intergenic
930338787 2:50084520-50084542 CCACGCTCACCAGGAACTCTAGG + Intronic
936403844 2:112185370-112185392 CCAGCCACACTTGGAGGCCTGGG - Intronic
938278431 2:130048555-130048577 CCAGGCAGACTTGGGTCTCTTGG + Intergenic
938329407 2:130439414-130439436 CCAGGCAGACTTGGGTCTCTTGG + Intergenic
938360541 2:130682089-130682111 CCAGGCAGACTTGGGTCTCTTGG - Intergenic
938436944 2:131288797-131288819 CCAGGCAGACTTGGGTCTCTTGG - Intronic
939746485 2:145976904-145976926 ACATGCACACTTGGGGCTATAGG + Intergenic
940625659 2:156172282-156172304 CAACACACACTGGGACCTCTTGG + Intergenic
946760627 2:222989642-222989664 CAACACAGACTTGGAGGTCTAGG - Intergenic
947516543 2:230809858-230809880 CCACGCCCACTTAGCGCTCCCGG - Intronic
947934389 2:233991063-233991085 CTACCAACACTTGGGGCTCTGGG - Intronic
1168848608 20:961554-961576 CCACGCCCACTCTGAGCTCTTGG + Intronic
1169869161 20:10233030-10233052 CCAGGCACACTTACAGCTCAAGG + Intronic
1172387074 20:34541493-34541515 CCCCGCAGACTTGGAGCGCAGGG + Intergenic
1173382654 20:42560111-42560133 CCAGGCTCACTGGGAACTCTGGG + Intronic
1174400820 20:50274978-50275000 CCAAGGTCACTGGGAGCTCTGGG - Intergenic
1174819375 20:53713688-53713710 CCAGGCACACTTGGTACTATGGG - Intergenic
1175311820 20:58017708-58017730 CCATGCAGACCTGGTGCTCTGGG + Intergenic
1180607123 22:17067200-17067222 CAACGCCCACTGGGAGCCCTTGG - Intergenic
1180613508 22:17112688-17112710 ACACACACTCTTGAAGCTCTTGG - Exonic
1182713174 22:32335143-32335165 CCAAGGACACTGGGAGCCCTGGG + Intergenic
1184753586 22:46503183-46503205 CCAAGCAGACTTGGAGCCCTTGG + Intronic
1185289894 22:50017972-50017994 CCAGGGCCACCTGGAGCTCTGGG + Intronic
954370243 3:50166368-50166390 CCACTCAGCCTTGGAGCTGTAGG - Intronic
954747668 3:52796180-52796202 CCACGCATAGCTGGAGCTCAGGG + Intronic
959957047 3:112251439-112251461 CCAAGCACACGTGGAGCCCTAGG + Intronic
961481044 3:127180973-127180995 CCAGGGACACTTGCAGCTTTAGG + Intergenic
967220718 3:187245884-187245906 CAAAGCACACTTGGAACTGTAGG - Intronic
969180630 4:5437923-5437945 CCCCACACACTTGGAGCTGATGG - Intronic
971109993 4:23574079-23574101 CCAAGAAAACTTGGAGCTCCTGG + Intergenic
976873281 4:89822536-89822558 CCACACTCACTTGGACATCTTGG - Intronic
981682324 4:147413798-147413820 CCACACACACTGGGGCCTCTTGG - Intergenic
984591471 4:181622267-181622289 CCTCTCACCCTTGCAGCTCTTGG + Intergenic
987218703 5:15767172-15767194 CAACGCACACTGGGGGCTGTCGG - Intronic
987299326 5:16582977-16582999 CCATACCCACATGGAGCTCTAGG + Intronic
988470445 5:31532434-31532456 CCACCCACACTGGGAGCTTGGGG - Exonic
988621617 5:32829345-32829367 CCACTCATACTTGGAGCTTATGG - Intergenic
989932757 5:49977439-49977461 CAGCGGACACTTGGAGCCCTTGG + Intergenic
991459718 5:66845129-66845151 ACACACACACTTGAAGTTCTAGG + Intronic
995749435 5:115438758-115438780 CCACACACACATGGAGGTCAGGG - Intergenic
996761639 5:126991995-126992017 CCACAAACACTAGCAGCTCTGGG + Intronic
999313589 5:150569503-150569525 CCACAGACACTGGGAGCTCTGGG + Intergenic
1000082329 5:157859572-157859594 CCAAGTACACTTAGATCTCTAGG + Intergenic
1001104991 5:168845156-168845178 CCATGCACCCTTGCCGCTCTTGG - Intronic
1002841730 6:912305-912327 CCACACACACTTGGATGCCTAGG - Intergenic
1003521327 6:6861085-6861107 CCACTCACACATGCAGCACTGGG + Intergenic
1003521332 6:6861137-6861159 CCACTCACACATGCAGCACTGGG + Intergenic
1005783662 6:29219670-29219692 CCACACACACTGGGACCTGTCGG - Intergenic
1009361439 6:62818862-62818884 TCACTCACGCTGGGAGCTCTAGG + Intergenic
1011430517 6:87281533-87281555 CCACAGCCACTTAGAGCTCTGGG + Intergenic
1014183144 6:118407222-118407244 CCAGGCACACATGGAGATCTGGG + Intergenic
1015488734 6:133800849-133800871 TTAGGCACACTTGGAGCCCTGGG - Intergenic
1016935036 6:149443404-149443426 CCACACACACTTGGAGGGTTGGG - Intergenic
1017802262 6:157907859-157907881 CCAAGCACAGTTGCTGCTCTCGG + Intronic
1023033639 7:36111941-36111963 CCCCGCAGCCTTGGTGCTCTTGG - Intergenic
1026150133 7:67781147-67781169 CAACACACACTAGGATCTCTTGG + Intergenic
1027340352 7:77201239-77201261 TCATGCAAACTTGGAGCACTTGG + Intronic
1029444611 7:100605086-100605108 CCCCGCAAAATTGGTGCTCTGGG - Exonic
1030836785 7:114297305-114297327 CCACGCAAACTTGGTGTGCTTGG + Intronic
1031100361 7:117472376-117472398 CCAAGAAAACTTGGAGTTCTTGG - Intronic
1045847435 8:106655122-106655144 CCAGTCACACTTGCAGCCCTAGG - Intronic
1051676398 9:19562852-19562874 CCCAGCACTTTTGGAGCTCTGGG + Intronic
1052713220 9:32082952-32082974 ATACTCATACTTGGAGCTCTGGG + Intergenic
1052979517 9:34437973-34437995 CCACGCCCACTCGGAACTCCAGG - Intronic
1060807597 9:126587478-126587500 CCTGGCCCGCTTGGAGCTCTGGG + Intergenic
1185764615 X:2715410-2715432 CCAGGGACACCTGGAGCTCCCGG - Intronic
1186743016 X:12537914-12537936 TCACTCACACTGGGAGCTGTAGG - Intronic
1187584658 X:20646845-20646867 CAACACACACTGGGACCTCTAGG + Intergenic
1188927042 X:36056525-36056547 CCCCACACACTTGGTGCTTTTGG - Intronic
1192459466 X:71304580-71304602 CCAAGCACAGATGAAGCTCTGGG + Exonic
1193268905 X:79506706-79506728 CCATGCACACCTGAAGCTGTTGG - Intergenic
1195241973 X:102960803-102960825 TCAGGCACACATGGAGCTCCAGG - Intergenic
1195750937 X:108161663-108161685 CCAGGCCCACCTGGGGCTCTTGG - Exonic
1197281487 X:124541942-124541964 ACACTCACTCTTGGAGCCCTAGG + Intronic
1200630839 Y:5584752-5584774 CCACACACACTGGGGTCTCTTGG - Intronic