ID: 1132640749

View in Genome Browser
Species Human (GRCh38)
Location 16:977293-977315
Sequence GCCACGCACACTTGGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640749_1132640757 12 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640757 16:977328-977350 TCCCGAAGGGGGTCTTGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1132640749_1132640755 1 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640755 16:977317-977339 AAGAAGCTGACTCCCGAAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1132640749_1132640754 0 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640754 16:977316-977338 CAAGAAGCTGACTCCCGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98
1132640749_1132640753 -1 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640753 16:977315-977337 CCAAGAAGCTGACTCCCGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1132640749_1132640759 13 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640759 16:977329-977351 CCCGAAGGGGGTCTTGAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132640749_1132640751 -2 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640751 16:977314-977336 GCCAAGAAGCTGACTCCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1132640749_1132640756 11 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640749 Original CRISPR GCCACGCACACTTGGAGCTC TGG (reversed) Intronic
900819834 1:4878201-4878223 GCCATTCACTCTTGCAGCTCTGG - Intergenic
900897158 1:5491467-5491489 GTAACACACACGTGGAGCTCGGG - Intergenic
905866277 1:41378471-41378493 GCCAGGTACCCCTGGAGCTCAGG - Intronic
906228868 1:44143377-44143399 GCCACTTTCACTTGGAGGTCTGG + Intergenic
906566645 1:46805820-46805842 CTCATGCACACATGGAGCTCTGG + Intronic
911211782 1:95147393-95147415 GCCAAGCACACCTTGAGCACAGG - Intronic
915288828 1:154869515-154869537 GCCAGGCCCACTTGTAGCTGTGG + Exonic
916094602 1:161337816-161337838 TCCAAACACACTTGGGGCTCTGG - Intronic
921168576 1:212525674-212525696 GTCATTCACACTTGCAGCTCAGG - Intergenic
922678810 1:227572689-227572711 GTCCAGCACACTTGGGGCTCCGG - Intronic
922702556 1:227770310-227770332 GTCAGGCTCACTTGGGGCTCAGG + Intronic
923074737 1:230600292-230600314 ACCACGCACACTTGTGGTTCAGG - Intergenic
924732830 1:246727746-246727768 GCCAAGCACACTGGCATCTCAGG - Intronic
1065020727 10:21500144-21500166 TCCACGCACACTTAGAGCCGAGG + Intergenic
1065341178 10:24707514-24707536 GTCACGCAGATTTGGAGCTTGGG - Intronic
1073704023 10:105961692-105961714 GCCAGTCTCACTGGGAGCTCTGG + Intergenic
1075032136 10:119030426-119030448 AACACGCACACCTGCAGCTCGGG - Exonic
1075305696 10:121365626-121365648 CCCACGCCCACCTGGAACTCGGG - Intergenic
1077477965 11:2799886-2799908 GCGTGGGACACTTGGAGCTCAGG - Intronic
1077948252 11:6926371-6926393 ACGCCGCACACTTGGAACTCTGG - Intergenic
1078620177 11:12899934-12899956 GCTACCCACATTTGGATCTCTGG - Intronic
1079251564 11:18791370-18791392 GCCACGCCCCCGTGGGGCTCTGG - Intronic
1081434053 11:43007500-43007522 GCCAAGAACACTTGCACCTCAGG - Intergenic
1085752916 11:79177733-79177755 GCCAGGCACCCTTGCACCTCTGG - Intronic
1089778707 11:120857917-120857939 GCCACCCACACTTGGAGTAGTGG + Intronic
1090116431 11:123979069-123979091 GCCAGGCACACTTGCTGCTGTGG + Intergenic
1090297686 11:125603644-125603666 ACCAGGCACCCTTTGAGCTCAGG - Intronic
1090619342 11:128547874-128547896 GCCACTCACACTGGCAGCTTTGG + Intronic
1091280226 11:134377578-134377600 CCCCCACACACCTGGAGCTCAGG - Intronic
1093934950 12:24990568-24990590 GTCAGGCACACTTGCACCTCAGG + Intergenic
1093982843 12:25493900-25493922 GCCACTCACCCTTGGAACTTAGG + Intronic
1101375631 12:104168948-104168970 GCCAACCAAACTTGGAGCTGGGG + Intergenic
1104843361 12:131834912-131834934 TCCACCCACACTGGGAGCACAGG + Intronic
1104898114 12:132174080-132174102 GCAACCCACACTGGGGGCTCAGG - Intergenic
1105720421 13:23108186-23108208 CCCCCGCACACCTGGAGCACAGG - Intergenic
1105925290 13:25002356-25002378 GCCACCCACACTTGTAACTCTGG + Intergenic
1113543309 13:111125528-111125550 TCCAAACACACTTGGAGCTGTGG - Intronic
1113948976 13:114060691-114060713 GCCGCGCACGCCCGGAGCTCAGG + Intronic
1116941220 14:50792794-50792816 TCCACGGACTCTTGGAACTCGGG + Exonic
1118347657 14:64951543-64951565 GCCACCCACACTCCCAGCTCTGG - Intronic
1120573697 14:86153821-86153843 GCCAAGCACACTGGCACCTCAGG - Intergenic
1123061819 14:105597962-105597984 TCCACGCACACGTCCAGCTCTGG + Intergenic
1123086557 14:105719693-105719715 TCCACGCACACGTCCAGCTCTGG + Intergenic
1123990061 15:25676431-25676453 GCCATGCACACTTACAGCTGGGG + Intergenic
1127799997 15:62469893-62469915 GCCATGCCCATTTTGAGCTCAGG - Intronic
1128405936 15:67338922-67338944 GCCAAGCACATTTGCAGATCAGG + Intronic
1129272441 15:74426383-74426405 GCCACACACAGGTGGAGGTCAGG - Intronic
1129737654 15:77975032-77975054 GCCACGCAGACTTGCAGGGCTGG - Intergenic
1132149020 15:99446800-99446822 GACACGCACACAGGGAGCACTGG + Intergenic
1132640749 16:977293-977315 GCCACGCACACTTGGAGCTCTGG - Intronic
1138376039 16:56564794-56564816 GAAATGCACACATGGAGCTCAGG - Intergenic
1141876147 16:86825931-86825953 GCCACACACACTGAGAGCTCAGG + Intergenic
1142114782 16:88350983-88351005 GCCACACACACTTGGAGGCTTGG - Intergenic
1142235149 16:88918535-88918557 GGGCCGCACGCTTGGAGCTCAGG - Intronic
1147058011 17:37849183-37849205 GCCACTCACACTTGGGGTTGAGG - Intergenic
1151198035 17:72445748-72445770 GCCAGGCACACCTGGACGTCGGG + Intergenic
1151698680 17:75731170-75731192 GCCAGCCACACTTGGAGGTTGGG + Intronic
1152728696 17:81959824-81959846 GCCAGGCCCACGGGGAGCTCAGG + Intronic
1153758601 18:8308203-8308225 GCCACTCACACTTGTAGGTGTGG - Intronic
1153893110 18:9536353-9536375 GCCACGCCCTCTGGGATCTCTGG + Exonic
1161474587 19:4477217-4477239 GCCACGCACACGTGCCGCACTGG + Intronic
1166500491 19:43337597-43337619 GCCCTGCAGACTTGGAGCTCAGG - Intergenic
1166509633 19:43396102-43396124 GCCCTGCAGACTTGGAGCTCAGG + Intergenic
1167693830 19:51002661-51002683 GCTCCGCCCACGTGGAGCTCGGG - Exonic
1168195653 19:54771941-54771963 GACACGCCCACCAGGAGCTCTGG - Intronic
926666636 2:15531712-15531734 GCCAAGCACACTTCTAACTCAGG + Intronic
929966419 2:46540793-46540815 GCCAGGAATACTTAGAGCTCTGG - Intronic
929978154 2:46654657-46654679 GCCACCCACACTGGGCGCTCAGG + Intergenic
930028203 2:47042664-47042686 CACACACACACTTGGGGCTCAGG - Intronic
932692027 2:73921392-73921414 GCCCCGCCCACTGGGAGCTCTGG + Intergenic
935060522 2:99603182-99603204 GCAAGGCACAGTTAGAGCTCAGG + Intronic
1169198288 20:3694875-3694897 GCCTGGCCCTCTTGGAGCTCAGG + Exonic
1171814962 20:29777957-29777979 GCCCAGCACACTGGGGGCTCTGG - Intergenic
1172193398 20:33075842-33075864 GCCAGGCACACTTGGAGGAGAGG - Intergenic
1172387072 20:34541492-34541514 GCCCCGCAGACTTGGAGCGCAGG + Intergenic
1174819377 20:53713689-53713711 GCCAGGCACACTTGGTACTATGG - Intergenic
1175311818 20:58017707-58017729 GCCATGCAGACCTGGTGCTCTGG + Intergenic
1175778912 20:61669919-61669941 GCCTCCCATGCTTGGAGCTCAGG - Intronic
1176184173 20:63769163-63769185 GCCACGCACACATGGGTGTCAGG + Intronic
1179629081 21:42665705-42665727 ACCAGGCACCCTTGGAGCCCAGG + Intronic
1182419619 22:30242610-30242632 GCACAGCACGCTTGGAGCTCAGG + Exonic
1184297637 22:43535226-43535248 GCCAGGCTCACTATGAGCTCAGG - Intronic
954747666 3:52796179-52796201 CCCACGCATAGCTGGAGCTCAGG + Intronic
954838786 3:53494159-53494181 GCCCCGCCCCCTGGGAGCTCAGG - Intergenic
963039345 3:141057166-141057188 GCTATACACACATGGAGCTCAGG - Intronic
968479805 4:828057-828079 TCCAAGCACACCTGGAGCTGGGG + Intergenic
972883657 4:43457849-43457871 GCCAATCCCACTTGGAGCTTTGG + Intergenic
974250534 4:59377934-59377956 GCCACAGGCACTTAGAGCTCAGG - Intergenic
974668820 4:65001649-65001671 GCCAAGAAGACTTGGAGCTGTGG + Intergenic
975735765 4:77379382-77379404 GCCAAGAAGACTTGCAGCTCAGG + Intronic
977917213 4:102607571-102607593 GCCATGCACACTGGGAGGTGGGG + Intronic
985535343 5:462059-462081 GCCACACTCACTTGAAGGTCTGG - Exonic
986167479 5:5287863-5287885 CCCACGCACTGGTGGAGCTCAGG + Intronic
988470447 5:31532435-31532457 ACCACCCACACTGGGAGCTTGGG - Exonic
992339524 5:75808288-75808310 GCCAATCCCACTGGGAGCTCAGG + Intergenic
994075652 5:95646749-95646771 GCCGCGCACGTCTGGAGCTCTGG + Intronic
995749437 5:115438759-115438781 GCCACACACACATGGAGGTCAGG - Intergenic
995871111 5:116744286-116744308 GCCAAGCACAGGTGGTGCTCAGG - Intergenic
996924463 5:128807821-128807843 GCCTCGAACTCCTGGAGCTCAGG - Intronic
999313587 5:150569502-150569524 TCCACAGACACTGGGAGCTCTGG + Intergenic
999461146 5:151758502-151758524 GCCACGCAGACTTGCAGTCCCGG - Intronic
1003521325 6:6861084-6861106 GCCACTCACACATGCAGCACTGG + Intergenic
1003521330 6:6861136-6861158 GCCACTCACACATGCAGCACTGG + Intergenic
1014183142 6:118407221-118407243 CCCAGGCACACATGGAGATCTGG + Intergenic
1016935038 6:149443405-149443427 GCCACACACACTTGGAGGGTTGG - Intergenic
1019601111 7:1884284-1884306 GCCACCCACCCATGGATCTCTGG + Intronic
1023069175 7:36411950-36411972 GCCAACCACACCTAGAGCTCAGG - Intronic
1027351147 7:77312792-77312814 GCCTTGCACACTTGCACCTCTGG - Intronic
1034285384 7:149880331-149880353 GCTAACCACACTGGGAGCTCGGG - Exonic
1035893605 8:3372713-3372735 GCCCAGCAGACTTGGAGCTTTGG - Intronic
1036614469 8:10377958-10377980 GACTCCCACACTGGGAGCTCTGG + Intronic
1037807607 8:22067119-22067141 GCCAGGCACACTGGAATCTCGGG - Exonic
1044463080 8:92470170-92470192 GCCCGGCTCTCTTGGAGCTCAGG - Intergenic
1049004889 8:139848213-139848235 GTGATGCACACTTGGTGCTCAGG - Intronic
1049371591 8:142270595-142270617 GGCATGCACACTTGGAGGGCAGG - Intronic
1049624993 8:143615920-143615942 GTCACTCACACTTGGTGCTGTGG - Intronic
1050847725 9:10244135-10244157 CCCACTCAAACTTTGAGCTCTGG + Intronic
1051123139 9:13773825-13773847 GCCACACAAACCTGGAACTCAGG - Intergenic
1062294096 9:135814552-135814574 GGCATGCACACTGGGTGCTCCGG + Intronic
1195396144 X:104412397-104412419 GCCAAGCACATTTGCAGCTGTGG + Intergenic
1201645360 Y:16223941-16223963 GTCACTCACACTGGGAGCTGTGG + Intergenic
1201657453 Y:16361381-16361403 GTCACTCACACTGGGAGCTGTGG - Intergenic