ID: 1132640750

View in Genome Browser
Species Human (GRCh38)
Location 16:977301-977323
Sequence GCTTCTTGGCCACGCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640750_1132640751 -10 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640751 16:977314-977336 GCCAAGAAGCTGACTCCCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 90
1132640750_1132640759 5 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640759 16:977329-977351 CCCGAAGGGGGTCTTGAGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1132640750_1132640754 -8 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640754 16:977316-977338 CAAGAAGCTGACTCCCGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 98
1132640750_1132640753 -9 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640753 16:977315-977337 CCAAGAAGCTGACTCCCGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1132640750_1132640755 -7 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640755 16:977317-977339 AAGAAGCTGACTCCCGAAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1132640750_1132640757 4 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640757 16:977328-977350 TCCCGAAGGGGGTCTTGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1132640750_1132640756 3 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640750 Original CRISPR GCTTCTTGGCCACGCACACT TGG (reversed) Intronic
900920979 1:5670235-5670257 TCTTCATGGACATGCACACTAGG + Intergenic
901342198 1:8505094-8505116 GCTTCTTTACCACATACACTGGG + Intronic
903910024 1:26716910-26716932 CCTTCCTGGCCAGGCACAGTTGG - Intronic
904441784 1:30536470-30536492 CCTTCTTGGCCACCCACAAGGGG + Intergenic
904445594 1:30570937-30570959 CCTCCTTAGCCACGTACACTGGG + Intergenic
904873226 1:33634850-33634872 GCTCCTTGGCCACTCACCCTGGG + Intronic
910935276 1:92481681-92481703 GCTCCTTTGCTACGTACACTGGG - Intronic
911183955 1:94885327-94885349 GCTTCGTGGCCAGTCACCCTCGG - Intronic
1062819377 10:522812-522834 GCTTGTGGGCCACGCAGACGGGG - Intronic
1063703960 10:8412653-8412675 GCATCTGGGACATGCACACTAGG - Intergenic
1063984845 10:11491417-11491439 GCTTCTTGGCCCTGCAAGCTTGG + Intronic
1065938518 10:30543179-30543201 GCTTCTTGCCCATGCAGAGTAGG - Intergenic
1066358938 10:34712022-34712044 GATTCCTGGCCAGTCACACTGGG - Intronic
1073424210 10:103446443-103446465 GCTTCTTGGACATGAGCACTAGG + Intergenic
1075155925 10:119975725-119975747 GATTGTTGCCCACCCACACTGGG + Intergenic
1077390081 11:2296782-2296804 GCCTCGTGGCCACCCCCACTGGG + Intronic
1080273695 11:30479065-30479087 GCTTCTTGTCCAGGCCCTCTGGG - Intronic
1081903901 11:46654143-46654165 TCTTCATGGCCAGGCACAGTTGG + Intronic
1082816521 11:57513432-57513454 GCTTCGGGGCCACTCACACAAGG + Intronic
1089257650 11:117202263-117202285 GCTTCTTTGCCAAGAACTCTTGG + Exonic
1089670699 11:120054938-120054960 GCTTCTTGGACAGTCACACTTGG + Intergenic
1090843874 11:130515136-130515158 GCTTCCTGGCCAGGCAGCCTGGG + Intergenic
1101239549 12:102824519-102824541 GCTTCTTCCCCACCCACACTTGG - Intergenic
1112160585 13:96863184-96863206 GTTTCATGGCCTTGCACACTGGG + Intergenic
1122413360 14:101537163-101537185 GCTCCTTGGCCCCGCACCCCAGG - Intergenic
1202839865 14_GL000009v2_random:111629-111651 GCCTCTTGGACACACACCCTGGG + Intergenic
1202909247 14_GL000194v1_random:101827-101849 GCCTCTTGGACACACACCCTGGG + Intergenic
1202884026 14_KI270722v1_random:87449-87471 GCCTCTTGGACACACACCCTGGG - Intergenic
1123806519 15:23879626-23879648 GGTTCTTGACCACACGCACTGGG + Intergenic
1132640750 16:977301-977323 GCTTCTTGGCCACGCACACTTGG - Intronic
1135181940 16:20282525-20282547 ACTCCTTGGCCAGGCACACAAGG - Intergenic
1139854445 16:69969327-69969349 CCATTTTGGCCAGGCACACTCGG + Intergenic
1139883425 16:70192242-70192264 CCATTTTGGCCAGGCACACTCGG + Intergenic
1140369085 16:74403277-74403299 CCATTTTGGCCAGGCACACTCGG - Intergenic
1143176689 17:4959626-4959648 TCTTATTGGCCACGGGCACTAGG + Exonic
1146121653 17:30201067-30201089 GTTTCTTGGCCGGGCACAGTGGG - Intronic
1146204090 17:30886619-30886641 ATTTCTTGGCCAGGCACAGTGGG + Intronic
1149529811 17:57386148-57386170 GCTACTTGGACACGCACAGCTGG - Intronic
1149875471 17:60228300-60228322 GTTTCTAGGCCAGGCACAGTGGG - Intronic
1150543063 17:66123379-66123401 TCTTCTTTGCCACACCCACTGGG + Intronic
1152527049 17:80894275-80894297 GCTTCCTGGCCTCACCCACTGGG - Intronic
1152808591 17:82370859-82370881 GCCTCTCGGCCATTCACACTTGG + Intergenic
1154363853 18:13688616-13688638 CCTTTTTGGGCACCCACACTTGG - Intronic
1158516622 18:58135935-58135957 GCTTCCTGGCCAACCACACAAGG - Intronic
1161575862 19:5053894-5053916 GCTGCGTGGCCAGGCACACCTGG + Intronic
1162067686 19:8136203-8136225 GCTTCCAGGCCACGCCCACCAGG - Exonic
1162830985 19:13284371-13284393 GCCTCTTGGCAACTCACCCTGGG - Intronic
1165885875 19:39077869-39077891 TATTCTTGGCCAGGCACAGTGGG + Intergenic
1165920710 19:39296362-39296384 GCTTTTTAGCCACGCAAAATGGG - Exonic
1202633179 1_KI270706v1_random:18894-18916 GCCTCTTGGACACACACCCTGGG - Intergenic
1202652702 1_KI270707v1_random:21160-21182 GCCTCTTGGACACGCACCCTGGG + Intergenic
1202659444 1_KI270708v1_random:54583-54605 GCCTCTTGGACACACACCCTGGG - Intergenic
926560044 2:14406821-14406843 GCCCCCTGGCCACGCACACATGG - Intergenic
933316036 2:80716427-80716449 GCTTCTTGCCCACTCCCACCAGG - Intergenic
933645226 2:84807269-84807291 CCTTCTTGACCACACACATTTGG - Intronic
940094511 2:149959123-149959145 GCTTCCTGACCTCGAACACTGGG + Intergenic
942310603 2:174653268-174653290 GCTTGTTGGCCACTCACCTTAGG - Intronic
948087821 2:235266016-235266038 GCTTCTCGGCCTAGCACACCTGG + Intergenic
1168969961 20:1924298-1924320 GCACCTGGGCCATGCACACTGGG - Intronic
1170307471 20:14955544-14955566 GCTTCTTGGCCACACAGGCCTGG - Intronic
1171415514 20:24977579-24977601 ATTTCTTGGCCAGGCACAGTGGG - Intronic
1171815719 20:29784498-29784520 TCTTCATGGACATGCACACTAGG - Intergenic
1174254969 20:49247791-49247813 GCTTCTTGGCCAGCCACTCATGG + Exonic
1176169436 20:63690324-63690346 GCATCTTCTCCACGCACACTGGG - Exonic
1176628604 21:9116540-9116562 GCCTCTTGGACACATACACTGGG + Intergenic
1176645405 21:9344812-9344834 GCCTCTTGGACACACACCCTGGG - Intergenic
1178844669 21:36164542-36164564 GCTTCTGGGCCAGGCACTGTGGG - Exonic
1179932023 21:44576947-44576969 GCTGCTTGGCCACACAGAATTGG + Intronic
1180319173 22:11305065-11305087 TCTTCATGGACATGCACACTAGG - Intergenic
1180326913 22:11438144-11438166 GCCTCTTGGACACACACCCTGGG - Intergenic
1180378536 22:12116909-12116931 GCCTCTTGGACACACACCCTGGG - Intergenic
1180418979 22:12796408-12796430 GCCTCTTGGACACACACCCTGGG + Intergenic
1184117230 22:42429292-42429314 GCTACTTGCCCAGGCACCCTGGG - Intronic
951371421 3:21854444-21854466 GCTTCATGGGCACGCAACCTTGG + Intronic
952236565 3:31486563-31486585 GCTTCTTGACCACAGAGACTAGG - Intergenic
952611916 3:35220298-35220320 TCTTCTTGGCCATGCCCATTTGG + Intergenic
953072131 3:39531247-39531269 GCATCCTGGCCACTCACACGCGG - Intergenic
956950850 3:74280533-74280555 GTCTCTTGGCCAGTCACACTGGG - Intronic
957094914 3:75769231-75769253 GCCTCTTGGACACACACCCTGGG + Intronic
958145082 3:89613566-89613588 ACTTCTTGGCCACACCCACTAGG + Intergenic
963088500 3:141460439-141460461 GCTGATGGCCCACGCACACTTGG - Intergenic
966596208 3:181726442-181726464 GCCTCTTGGCCAGGGACTCTGGG + Intergenic
1202741483 3_GL000221v1_random:60256-60278 GCCTCTTGGACACACACCCTGGG + Intergenic
968641749 4:1718279-1718301 GCTGCTGGGCCACGTGCACTCGG + Exonic
969049205 4:4360651-4360673 GCTGGTTTGCCACGCACACCGGG + Intronic
970566815 4:17339726-17339748 GGATCTTGCCCACTCACACTGGG + Intergenic
971245242 4:24921430-24921452 GCTCCTGGGCCATGCCCACTGGG - Intronic
973362805 4:49180865-49180887 GCCTCTTGGACACACACCCTGGG - Intergenic
973398292 4:49615988-49616010 GCCTCTTGGACACACACCCTGGG + Intergenic
977264909 4:94842086-94842108 GCTACTTGTCCAAGCACCCTGGG - Intronic
979780930 4:124650815-124650837 GCTTCTTGGCCCCGCACAGCCGG + Intergenic
1202760156 4_GL000008v2_random:102375-102397 GCCTCTTGGACACACACCCTGGG - Intergenic
987045292 5:14102077-14102099 TCTTCTTGGCCACACCCACCTGG - Intergenic
988434066 5:31153212-31153234 GCTCCTTGGCCACCCACCATTGG + Intergenic
988834009 5:35013938-35013960 GCTTCTGGGCCTCGTACATTGGG - Intronic
990089542 5:52024796-52024818 TCTTGATGGCCACCCACACTGGG + Intronic
990699519 5:58460190-58460212 GCTTCCCGGCCACGCGCGCTCGG - Exonic
999369190 5:151042864-151042886 GGTTCCTGGCCACGCCCACAGGG - Intronic
999418433 5:151419897-151419919 GCTCCCTGACCACGCCCACTGGG - Intergenic
1010978940 6:82348313-82348335 TCTTCTTGGCCACACCCACTTGG + Intergenic
1011843905 6:91537694-91537716 GCTTTTTTTCCAAGCACACTTGG + Intergenic
1013048745 6:106512066-106512088 CCTTCTTCGGCACACACACTGGG - Exonic
1013385710 6:109628287-109628309 AGCTCTTGGCCACACACACTTGG + Intronic
1029110913 7:98212618-98212640 GCTTCTTGTCCGCGCGCACGTGG - Exonic
1029790832 7:102841467-102841489 GCTTCTTGCCCACTCCCATTGGG - Intronic
1034735598 7:153426447-153426469 GCTTCTTAGCCACCCAGAGTGGG + Intergenic
1039433245 8:37542253-37542275 TAGTCTTGGCCAGGCACACTGGG + Intergenic
1042533399 8:69835973-69835995 GCTTATGGGACACGTACACTGGG - Intergenic
1047251270 8:123183353-123183375 GCTACTTGGCCACGGAGACAGGG - Intronic
1049032992 8:140050825-140050847 GCTTCCAGGGCACACACACTGGG + Intronic
1049754551 8:144304027-144304049 GCTTCTTGGCCACGTGCACCAGG + Intronic
1058110417 9:101026770-101026792 GCTTCTTGGCCAGGCAACCCTGG + Intergenic
1062442424 9:136576722-136576744 GCCTCTTGGCCTCCCACCCTTGG + Intergenic
1203760726 EBV:12182-12204 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203761655 EBV:15254-15276 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203762584 EBV:18326-18348 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203763513 EBV:21398-21420 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203764442 EBV:24470-24492 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203765371 EBV:27542-27564 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203766300 EBV:30614-30636 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203767229 EBV:33686-33708 CCCTCTTGGCCACGCACCCCGGG + Intergenic
1203751450 Un_GL000218v1:84219-84241 GCCTCTTGGACACATACACTGGG + Intergenic
1203367400 Un_KI270442v1:270814-270836 TCTTCATGGACATGCACACTGGG - Intergenic
1203710121 Un_KI270742v1:90180-90202 GCCTCTTGGACACACACCCTGGG + Intergenic
1203540931 Un_KI270743v1:87269-87291 GCCTCTTGGACACACACCCTGGG - Intergenic
1187472316 X:19580131-19580153 GCTTTGGGGCCAGGCACACTGGG - Intronic
1196008888 X:110865357-110865379 GCTTCTGGCACAGGCACACTAGG + Intergenic
1199056175 X:143297598-143297620 GTTTCCTGGACATGCACACTAGG + Intergenic
1201071294 Y:10149416-10149438 TCTTCATGGACATGCACACTAGG + Intergenic