ID: 1132640756

View in Genome Browser
Species Human (GRCh38)
Location 16:977327-977349
Sequence CTCCCGAAGGGGGTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132640747_1132640756 12 Left 1132640747 16:977292-977314 CCCAGAGCTCCAAGTGTGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640749_1132640756 11 Left 1132640749 16:977293-977315 CCAGAGCTCCAAGTGTGCGTGGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640750_1132640756 3 Left 1132640750 16:977301-977323 CCAAGTGTGCGTGGCCAAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640746_1132640756 16 Left 1132640746 16:977288-977310 CCAGCCCAGAGCTCCAAGTGTGC 0: 1
1: 0
2: 0
3: 9
4: 266
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1132640745_1132640756 17 Left 1132640745 16:977287-977309 CCCAGCCCAGAGCTCCAAGTGTG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132640756 Original CRISPR CTCCCGAAGGGGGTCTTGAG AGG Intronic
901784642 1:11616757-11616779 CTCCCTCAGGGGGTCCTCAGTGG - Intergenic
903818786 1:26084992-26085014 ATGCAGAAGAGGGTCTTGAGGGG - Intergenic
904949812 1:34227679-34227701 CACCCAAATGGGGCCTTGAGAGG + Intergenic
909056133 1:70823319-70823341 CTTCCCAAGGTGGTCTTCAGGGG - Intergenic
1069772964 10:70911070-70911092 CTCCTGAAGGGAGGCCTGAGAGG - Intergenic
1070690151 10:78518354-78518376 CTGCTGACGGGGGTCCTGAGTGG + Intergenic
1070762853 10:79035555-79035577 CTCCCCAAATGGGTGTTGAGTGG - Intergenic
1073064470 10:100750027-100750049 ATCCCCAAAGGGGTCTGGAGAGG + Intronic
1073224087 10:101901707-101901729 CTACAGAAGGGAGGCTTGAGAGG + Intronic
1076895734 10:133310469-133310491 CTGCCGAAGGGAGGCTGGAGGGG + Intronic
1084701410 11:70788609-70788631 CACCCAATGGGGGTCTTGGGAGG + Intronic
1084955728 11:72690365-72690387 CTGCAGAAGTGGGTCTTGGGAGG + Intronic
1092929041 12:13298003-13298025 ATCCCCAAAGGGGGCTTGAGAGG + Intergenic
1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG + Intronic
1094618878 12:32060920-32060942 TTCCCGAAGGGGCTGGTGAGAGG - Intergenic
1104119865 12:125788991-125789013 CTCCAGAGGAGGGTCTTGGGAGG + Intergenic
1114237029 14:20832765-20832787 CTCACGGAGGGGGCCTTTAGCGG + Intergenic
1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG + Intronic
1117297791 14:54394824-54394846 CTCCCGAAGCGTGGCTAGAGTGG + Intergenic
1118696922 14:68394702-68394724 CTCCCCCAGTGGGTTTTGAGGGG + Intronic
1118734654 14:68692577-68692599 ATCCTGAATGAGGTCTTGAGAGG + Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1122602506 14:102928648-102928670 GTCCCGAAGCGGGGCTTGGGAGG + Intronic
1124704921 15:31955799-31955821 CTCCCCAAGGAGGTCTAGACAGG - Intergenic
1124794476 15:32763520-32763542 CTCCACATGGGCGTCTTGAGTGG - Intergenic
1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG + Intergenic
1129255762 15:74333151-74333173 CTCCAGAAGGGAGTTTTGAGAGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132876898 16:2143993-2144015 CTCCAGAGGAGGGTCTTGGGAGG + Intronic
1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG + Intergenic
1137973059 16:53004830-53004852 CTCTAGAAGGGGGCTTTGAGAGG + Intergenic
1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG + Intergenic
1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG + Intergenic
1143995865 17:11005980-11006002 GACTCAAAGGGGGTCTTGAGGGG - Intergenic
1144457863 17:15433597-15433619 GTCCTAAAGGGGGTCTTCAGAGG - Intergenic
1147131080 17:38409475-38409497 CTCCGCAAGGGGTTTTTGAGAGG + Intergenic
1147746440 17:42697643-42697665 GTTCGGAAGTGGGTCTTGAGGGG - Exonic
1147845137 17:43399477-43399499 CTCCCTGGGGGGGTCGTGAGGGG - Intronic
1148105176 17:45115025-45115047 CTCCTGAAGGGAGTCTGGAAAGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG + Intergenic
1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG + Exonic
1166304619 19:41930598-41930620 CTCCCAAAGGGTGTCCTGTGTGG - Intergenic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
1168722277 19:58560735-58560757 CTCCCTAAAGTGGTCCTGAGCGG - Intergenic
924988267 2:289430-289452 CTCTCGCAGGGGGTCTGGGGAGG - Intergenic
929599056 2:43193701-43193723 CTCCCTAAGTGGGGCTTTAGGGG - Intergenic
932140455 2:69272942-69272964 CTCCCTGAGGGTGTGTTGAGTGG - Intergenic
933167127 2:79088443-79088465 CTTCTGAAGTAGGTCTTGAGAGG - Intergenic
935822472 2:106908083-106908105 CTCCCTAATAGGGTCTTCAGAGG - Intergenic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
1174798741 20:53544593-53544615 CTCCAGCAGTGGTTCTTGAGTGG - Intergenic
1179363866 21:40737806-40737828 CCTCAGAAGGGGCTCTTGAGTGG + Intronic
964487995 3:157205799-157205821 CTCCAAAAGGTGGACTTGAGAGG + Intergenic
966128998 3:176614988-176615010 CTCAGTAAGGGGGTGTTGAGAGG - Intergenic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
974700638 4:65440828-65440850 CTCCCTATGGGTGTCTTCAGAGG + Intronic
978310653 4:107381958-107381980 GTCCCAATGGGGGTCTTGAGTGG - Intergenic
1000089015 5:157913738-157913760 CTCCAGAAGGCGGGCTTGACAGG + Intergenic
1003709883 6:8577323-8577345 CTCTCCATGGGGGTTTTGAGGGG + Intergenic
1004604536 6:17181703-17181725 GTCTGGAAGGGGGTCATGAGTGG - Intergenic
1008842992 6:55927224-55927246 CTCCCGAAGAGGGAAGTGAGAGG + Intergenic
1016371027 6:143374269-143374291 GACTCAAAGGGGGTCTTGAGAGG + Intergenic
1018818726 6:167356240-167356262 CTCCTGAAGGGAGTCTCGGGTGG - Intronic
1045363003 8:101450152-101450174 TTCCTGAAGGGGGAGTTGAGTGG + Intergenic
1049577805 8:143397760-143397782 CTCCCCAAGGGGCTCTGGCGAGG + Intergenic
1049703043 8:144023677-144023699 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1049703277 8:144024487-144024509 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1060643898 9:125261942-125261964 CTCACCAAGGGGGTCATGCGGGG - Exonic
1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG + Intronic
1185925089 X:4136985-4137007 AACCCGAAGTGTGTCTTGAGTGG + Intergenic
1189898983 X:45686381-45686403 TTCCCAAAGTGGGTGTTGAGTGG + Intergenic
1201465003 Y:14270578-14270600 CTTCAGATGGGGTTCTTGAGTGG - Intergenic