ID: 1132641346

View in Genome Browser
Species Human (GRCh38)
Location 16:979961-979983
Sequence GGCACTGCAGACGGAGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132641335_1132641346 9 Left 1132641335 16:979929-979951 CCGAGCGGAGGGCAGGGCCTCCA 0: 1
1: 0
2: 2
3: 29
4: 263
Right 1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 210
1132641341_1132641346 -8 Left 1132641341 16:979946-979968 CCTCCAGGGGGAAGAGGCACTGC 0: 1
1: 0
2: 0
3: 21
4: 255
Right 1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 210
1132641334_1132641346 10 Left 1132641334 16:979928-979950 CCCGAGCGGAGGGCAGGGCCTCC 0: 1
1: 0
2: 4
3: 26
4: 279
Right 1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 210
1132641333_1132641346 11 Left 1132641333 16:979927-979949 CCCCGAGCGGAGGGCAGGGCCTC 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 210
1132641327_1132641346 30 Left 1132641327 16:979908-979930 CCACGGAAGGATGCGGGGACCCC 0: 1
1: 0
2: 1
3: 12
4: 96
Right 1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG 0: 1
1: 0
2: 2
3: 15
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132641346 Original CRISPR GGCACTGCAGACGGAGGTGT GGG Intronic
900131303 1:1088349-1088371 GGCACTGCAGATGGGGGTCTTGG - Intronic
901774985 1:11554349-11554371 GGCCCTGCAGAACGAGCTGTTGG - Intergenic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
902631093 1:17705160-17705182 GGCACAGCAGATGTAGGTGTTGG + Intergenic
903145470 1:21369280-21369302 GGGCCTGCAGACCCAGGTGTAGG - Intergenic
904409563 1:30317317-30317339 GACACTGCAGACATAGGTGGTGG - Intergenic
905278378 1:36833597-36833619 GGCATTGCAGACAGAGGTTGGGG + Intronic
906693923 1:47811362-47811384 TGCAGGGCAGATGGAGGTGTGGG - Intronic
907045111 1:51295968-51295990 GGCACTGGGGAGGGAGGAGTAGG - Intronic
907278187 1:53328288-53328310 GGCTCTGCAGACGCAGGGATGGG + Intergenic
909643148 1:77888790-77888812 GGGAGTGGAGACGGAGGTGTCGG + Intronic
912910958 1:113759052-113759074 GGCACTGAGGACGGAGGTCCCGG - Exonic
913546343 1:119872590-119872612 GGCACAGCATACTGAGCTGTGGG + Intergenic
913555620 1:119963698-119963720 GGGATTGCAGATGCAGGTGTAGG + Exonic
914755109 1:150557996-150558018 GGCACTGCAGCTGGCGGTGCTGG - Exonic
915569624 1:156737451-156737473 GACACTGCAGGAGGAGGTGATGG - Exonic
915892100 1:159782055-159782077 GGCACAGAAGAAGGAGCTGTGGG + Intronic
917492205 1:175507146-175507168 ACCACTGCAGAGGGAGGTGGAGG - Intronic
920843790 1:209576778-209576800 GGCAAGGCAGAAGGAGGGGTTGG + Intergenic
922239769 1:223748075-223748097 AGCACTGCAGATGGAGGGGAAGG - Intronic
922577456 1:226671751-226671773 GGCACTGCAGACAGAGGGAGCGG + Intronic
922675835 1:227548278-227548300 AGCTCTGCAGAGGGTGGTGTAGG + Intergenic
922872937 1:228917680-228917702 TGCACAGCAGACACAGGTGTGGG + Intergenic
923171501 1:231421638-231421660 GGCACTGCAGCCGGCGGCGCGGG + Exonic
924424997 1:243942748-243942770 GGGACTGAAGACCGCGGTGTCGG - Intergenic
1062820910 10:534048-534070 GTCACTGCAGAAGGGGGCGTGGG - Intronic
1063531839 10:6840576-6840598 GGCACTGCAGACTGGGTGGTGGG - Intergenic
1067920489 10:50451561-50451583 GGCAATGCAGACTGAGGGCTTGG + Intronic
1070398156 10:76030988-76031010 GGCACTGCAGTTGGAGTGGTGGG + Intronic
1072662370 10:97370781-97370803 GGCACTTCAAACGGGGCTGTGGG + Exonic
1073369465 10:102974143-102974165 TTCACTTCAGATGGAGGTGTGGG + Intronic
1073846965 10:107567883-107567905 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
1073990942 10:109261598-109261620 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
1075418032 10:122279964-122279986 GACACGGCAGAAGGAAGTGTTGG - Intronic
1075879457 10:125837864-125837886 GCCACTGCAGTTGGAGCTGTCGG - Intronic
1076349913 10:129808625-129808647 GGCACTGCTGAGGCAGGAGTTGG + Intergenic
1076383124 10:130038618-130038640 GCCAGGACAGACGGAGGTGTGGG + Intergenic
1076667668 10:132102367-132102389 GCCACTGCAGACGGAGGGGCTGG - Intergenic
1076993545 11:288041-288063 GCCACTCCAGGAGGAGGTGTGGG + Intergenic
1077066699 11:644203-644225 GGCACTGCAACCGGCCGTGTGGG + Intergenic
1077328447 11:1973612-1973634 TGCACTGCAGAGGGGGCTGTGGG + Intronic
1078078287 11:8181249-8181271 GGCACTGCAGATGCAGAAGTGGG - Intergenic
1081122647 11:39285696-39285718 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
1081800043 11:45852271-45852293 GGCATTGGAGATGGTGGTGTTGG - Intronic
1083638122 11:64131167-64131189 GGCACTGCAGAGGGAAATGGGGG + Intronic
1083831602 11:65237015-65237037 GCCAGTGCAGATGGAGGTGGGGG - Intergenic
1084066191 11:66705645-66705667 GGCACTGGAGAGGGAGGGGCTGG - Intronic
1084479282 11:69409318-69409340 GGCATTGCAGAAGGATGTGCTGG - Intergenic
1085387087 11:76163614-76163636 GGCACTCTGGACGGAGGTGCTGG + Intergenic
1087339204 11:96881183-96881205 GGCACAGCAGAGAGAGGTCTTGG + Intergenic
1202811425 11_KI270721v1_random:28791-28813 TGCACTGCAGAGGGGGCTGTGGG + Intergenic
1091510764 12:1123045-1123067 GGCACTGCTTACGGTGGTGATGG + Intronic
1092795546 12:12107475-12107497 AGCACAGCAGGCCGAGGTGTTGG - Intronic
1101523285 12:105504534-105504556 GGCACAGCCGAAGGAAGTGTAGG - Intergenic
1101902449 12:108800643-108800665 GGGACTCCAGACGCAGGAGTTGG - Intronic
1103007784 12:117435756-117435778 GGCAATGAAGATGGTGGTGTGGG - Intronic
1104697217 12:130872376-130872398 GGAACGGCGGCCGGAGGTGTAGG - Intronic
1104814908 12:131640071-131640093 GGCACTGCAGGTGGAGGGGTTGG - Intergenic
1104848156 12:131857571-131857593 GGCCCTGCAGCCAGTGGTGTTGG + Intergenic
1104946124 12:132415612-132415634 GGCACGGGAGACGGAGCTGGTGG - Intergenic
1105806239 13:23953213-23953235 GGCCCTGCAGATGGAGTTGTTGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1113633138 13:111901525-111901547 GGCATTGGAGTCGGAGGTTTGGG + Intergenic
1114266991 14:21078429-21078451 GGCACTGCAGAGGGATGGGGGGG + Exonic
1116356424 14:43936874-43936896 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1118720009 14:68587200-68587222 GGCACTGCAGAGGTTGGGGTTGG + Intronic
1127284860 15:57523626-57523648 GAAACTGCAGAAGGAGGTGAGGG + Exonic
1128247491 15:66143188-66143210 GGAACTGAAGACGGTGGTGGTGG + Intronic
1129330820 15:74826400-74826422 GGCACTGCTGACAGAGGATTAGG - Intergenic
1131675550 15:94667128-94667150 GGTAGTGGAGACGGAGGTGATGG - Intergenic
1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG + Intronic
1136620322 16:31424101-31424123 GACATTGCAGAAGAAGGTGTTGG + Exonic
1137587958 16:49675466-49675488 GGCACCGCTGAGGGAGGGGTGGG - Intronic
1137642675 16:50046515-50046537 GGCGCTGGAGAAGGAGCTGTCGG + Intergenic
1138099889 16:54244183-54244205 GGCACTGTTTACGGAGATGTGGG + Intergenic
1143093979 17:4466975-4466997 GACACTCCAGAAGCAGGTGTGGG + Intronic
1143269450 17:5665069-5665091 GGCCCTGCAGACGTGGGAGTGGG + Intergenic
1143670661 17:8393552-8393574 GGCAGTGGAGGCAGAGGTGTAGG - Intronic
1144319842 17:14104067-14104089 GACACTGCAGAGGGCTGTGTGGG - Intronic
1146767812 17:35539834-35539856 GGCACTGCAGATAGATATGTCGG + Intergenic
1147364768 17:39952714-39952736 GGCGCTGCAGGTGGAGGTGAAGG + Intergenic
1147548286 17:41420069-41420091 GGCACTGGAGACTGGGGTCTTGG - Intergenic
1148464734 17:47858035-47858057 GGCACTGGAGACGAAAGTCTGGG - Intergenic
1151235861 17:72719494-72719516 GCCACTACAGAGGGAGCTGTGGG - Intronic
1152193639 17:78903364-78903386 GGCACTGTTTAAGGAGGTGTGGG + Intronic
1152585785 17:81188893-81188915 GTCAGTGTAGACGGAGGTGGAGG + Intergenic
1159651750 18:70986415-70986437 GGCAATGCAGAGGGAAATGTAGG + Intergenic
1159985189 18:74833497-74833519 AGCACTGCACAGAGAGGTGTAGG + Intronic
1160276914 18:77445418-77445440 GGTACTGCAGAAGGAAGCGTTGG - Intergenic
1160666881 19:335021-335043 GGCCCTGCAGACGGAGCTTAAGG - Intronic
1161395848 19:4044501-4044523 GGCACTGCAGACGGGGGCTCCGG + Exonic
1161644422 19:5444415-5444437 GACTCTGCAGGCAGAGGTGTTGG - Intergenic
1162661617 19:12173759-12173781 GCCACTGCTGTCGGATGTGTGGG + Intronic
1163704686 19:18805315-18805337 GGCACTGCTGGGGGAGGTCTGGG - Intergenic
1164407917 19:27971119-27971141 TGCAAGGCAGGCGGAGGTGTTGG + Intergenic
1164537774 19:29099194-29099216 GGCACTGCAGGGGGTGGTGGGGG - Intergenic
1165067471 19:33237413-33237435 GGCACTGCAGGGGCAGGTGGAGG - Intergenic
1165229965 19:34380804-34380826 GGCACTGGAGGCAGAGATGTGGG - Intronic
1165808361 19:38595888-38595910 GGGACTGCAGCTGGAGGGGTGGG + Intronic
1166313845 19:41977845-41977867 GGCAGTGCAGAGGGAGGTTGGGG + Intronic
925328081 2:3038116-3038138 GGCACTGCTGAAGGTGGTGGGGG - Intergenic
927842277 2:26453394-26453416 GGCAGAGCAGACGGAGATGGAGG + Exonic
929484689 2:42342894-42342916 GGCACTGCTGCAGGATGTGTTGG - Intronic
930838872 2:55824782-55824804 GGAACTGCAGCCGCTGGTGTTGG - Intergenic
931800228 2:65750867-65750889 GGCTCTGAAGATGGAGGTGGAGG - Intergenic
931870963 2:66459226-66459248 GGCACTGCAGGCAGAGGAGAAGG + Intronic
933914841 2:86979615-86979637 GGCACTGTAGATGGATGAGTGGG + Intronic
934008153 2:87790285-87790307 GGCACTGTAGATGGATGAGTGGG - Intronic
934925510 2:98379508-98379530 GGCACTGTGGTCGCAGGTGTTGG + Intronic
935628177 2:105188623-105188645 GGCACTGCAGCAGCAGCTGTGGG - Intergenic
935771790 2:106431221-106431243 GGCACTGTAGATGGATGAGTGGG - Intronic
935908283 2:107864720-107864742 GGCACTGTAGATGGATGAGTGGG + Intronic
935994689 2:108756951-108756973 GGCACTGTAGATGGATGAGTGGG + Intronic
937404107 2:121611349-121611371 GGAACTGGAGGAGGAGGTGTTGG + Intronic
937597937 2:123692311-123692333 GACTCTGCAGATGGGGGTGTGGG + Intergenic
938766059 2:134461089-134461111 GGCACTGCAGAGGGGAGTGACGG - Intronic
944821972 2:203440758-203440780 GGCACTGGAGGAGTAGGTGTGGG + Exonic
945109541 2:206349246-206349268 GGCAATGCAGAGGGAAATGTGGG - Intergenic
948788532 2:240365410-240365432 GACACTGCACACGGATGTCTGGG + Intergenic
1169339425 20:4784914-4784936 GGCACTGCAGCTGCAGGAGTGGG + Intronic
1170156636 20:13274733-13274755 TGCTCTGCAGAAGCAGGTGTTGG - Intronic
1171257225 20:23698577-23698599 TGCACTGCAAAGGGAGGTGCAGG + Intergenic
1171264589 20:23760431-23760453 TGCACTGCAAAGGGAGGTGCAGG + Intergenic
1171304812 20:24096165-24096187 GGCACAGCAGAAGGAAATGTGGG - Intergenic
1171425908 20:25048545-25048567 GGCACTGCAGCCTAAGCTGTTGG + Intronic
1172146498 20:32761950-32761972 GGCACTGCGGCTGGAGGTGGGGG + Intergenic
1174282090 20:49446874-49446896 GGCACTTCAGAGGGAGATGAGGG - Intronic
1174295091 20:49540102-49540124 GGCAGAGCAGAGGGAGGGGTAGG + Intronic
1175738945 20:61406940-61406962 GGCAGAGCAGACGGAGGTCCAGG - Intronic
1175752053 20:61505481-61505503 AGCACTGCAGATGGAGGAGGCGG + Intronic
1175892126 20:62320609-62320631 GGCACAGCAGCTGGAGGTGCTGG - Exonic
1179490228 21:41736483-41736505 GGCACTGCAGAGGGAGGGGCAGG - Intergenic
1181319166 22:21991445-21991467 GGCACTGGAGATGGGGTTGTCGG + Intergenic
1183256169 22:36763833-36763855 GGCATTGCAGAGGTAGCTGTGGG - Intronic
1184037646 22:41926281-41926303 GGCGCTGCAGCCGCAGGAGTCGG - Exonic
1184212854 22:43046634-43046656 TGCACTGCAGAAGGAGATGCTGG + Intronic
1185021733 22:48380432-48380454 TGCTCTGCAGAAGCAGGTGTGGG + Intergenic
1185274565 22:49944731-49944753 GGCACTGCAGCCTGAGGTCTGGG - Intergenic
950453465 3:13078758-13078780 GGCGCTGGAGCCGGAGGTCTGGG + Intergenic
951520908 3:23610022-23610044 GGCACAGCAGGTGGAGGTGGAGG + Intergenic
951669467 3:25164022-25164044 AGGAGTGCAGACAGAGGTGTAGG + Intergenic
954630939 3:52047355-52047377 GGCTCTTCAGACGGAGGACTGGG - Intergenic
954670353 3:52287851-52287873 GGCACCGCGGCCGGAGCTGTGGG + Exonic
954867124 3:53739180-53739202 GGCACTGCAGAGCAAGGAGTAGG - Intronic
960224955 3:115158040-115158062 GGCAGTGCAGAGGGAAATGTAGG + Intergenic
960968599 3:123123234-123123256 GCCACTGCAGAGGGAGTTTTAGG + Intronic
961171724 3:124802034-124802056 AGCACTGCAGAGGGAGCTGTTGG - Intronic
961743257 3:129046871-129046893 GGCACGGCGGAGGTAGGTGTTGG + Intergenic
963839693 3:150092933-150092955 GGGACTGCTTACAGAGGTGTAGG + Intergenic
967891931 3:194369788-194369810 GTCACTGCAGAGGGCAGTGTTGG + Intergenic
968285187 3:197504510-197504532 GACCCTGCAGACGGAGGGATGGG - Intergenic
968563249 4:1295967-1295989 GGCAGTGCAGACGTGGGTGAGGG - Intronic
968563306 4:1296168-1296190 GGCAGTGCAGACGTGGGTGAGGG - Intronic
968661575 4:1800887-1800909 AGCTCTGCAGAGGGTGGTGTAGG + Intronic
969389417 4:6879804-6879826 GGCACTGCAGATGGGTGTGTTGG - Intronic
969389439 4:6879928-6879950 GGCACTGCAGACGGGTGTGTTGG - Intronic
969389498 4:6880355-6880377 GGCACTGCAGACGGGTGTGTTGG - Intronic
969623853 4:8292619-8292641 GGCAAGGGAGACGCAGGTGTGGG + Intronic
969704989 4:8786808-8786830 GAAAATGCAGACGGAGGTGCAGG + Intergenic
970601959 4:17647705-17647727 GGCACTGCAGGCCGAGCTGAGGG - Exonic
983136687 4:164092627-164092649 AGCACTGCAGACGAAAGTTTTGG - Intronic
983723819 4:170893436-170893458 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
984884964 4:184441994-184442016 GCCAGGTCAGACGGAGGTGTGGG - Intronic
985795707 5:1960389-1960411 GCCACTCCACACGGAGGTGCAGG + Intergenic
985864422 5:2503182-2503204 GGCAGTACAGATGGAGGTGCAGG - Intergenic
988712759 5:33794586-33794608 GGCAATGGAGACCGAGGTGCAGG + Intronic
994203285 5:97003038-97003060 AGCACTGGGGATGGAGGTGTAGG + Intronic
994440781 5:99800471-99800493 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
996304469 5:122031016-122031038 GGCACTGCATAAGTAGGTGAAGG + Intronic
1001853899 5:174994332-174994354 GGCATTGCGGACGCTGGTGTTGG + Intergenic
1004179402 6:13367910-13367932 GGCACTCCAGCCGCAGATGTGGG + Intronic
1006563936 6:34937994-34938016 GTCACTACAGAGGGAGGTGTGGG - Intronic
1008220852 6:48852130-48852152 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1009377528 6:62990829-62990851 GGCAATGCAGAGGGAACTGTGGG - Intergenic
1011088640 6:83570861-83570883 GGCAGTGCAGAGGGAAATGTGGG + Intronic
1011870478 6:91886403-91886425 GGCATTGCAGATGGAAATGTAGG + Intergenic
1013033719 6:106360700-106360722 AGCACTGCAGCCCGAGCTGTTGG - Intergenic
1013095532 6:106941292-106941314 CCCACTGCAGAAGGATGTGTTGG + Intergenic
1013468461 6:110438807-110438829 GGCGATGCACACGAAGGTGTAGG + Exonic
1013617726 6:111860298-111860320 TCCACTGAAGAGGGAGGTGTTGG - Intronic
1014407484 6:121069242-121069264 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG + Exonic
1018350650 6:162955792-162955814 GGCACTGGAAATGGATGTGTGGG + Intronic
1018941346 6:168310379-168310401 GTCACTGCAGACGGAGGCACAGG + Exonic
1019309731 7:354103-354125 GGCGCTGGAGACGGAGGCCTGGG + Intergenic
1019449019 7:1086933-1086955 GGCTCTCCAGGCGGAGGGGTGGG - Exonic
1023532820 7:41175890-41175912 GGGATTGGAGATGGAGGTGTTGG - Intergenic
1029372537 7:100158582-100158604 GGCGCAGCAGCCGGAGGTGTCGG - Exonic
1029729054 7:102427295-102427317 GGAACTGAACACAGAGGTGTAGG + Intergenic
1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG + Intergenic
1034320215 7:150173157-150173179 GGCAGTGCAGAGGGAAATGTGGG - Intergenic
1034734111 7:153412920-153412942 GGCAGTGCAGAAGGAGATGGCGG + Intergenic
1034772533 7:153794064-153794086 GGCAGTGCAGACGGAAATGTGGG + Intergenic
1035330972 7:158097232-158097254 GGCACTGGGGAAGGAGGTGGAGG + Intronic
1036049875 8:5184491-5184513 GGCACTACAGACAGAGATCTTGG - Intergenic
1037689510 8:21170490-21170512 GGCGCTGCACAGGGAGGTGAGGG + Intergenic
1037815171 8:22108229-22108251 GGCGCTGCAGCGGGAGGTGAAGG - Exonic
1038280429 8:26159210-26159232 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
1038672907 8:29596757-29596779 AGCACTGTAGATGCAGGTGTGGG + Intergenic
1043280518 8:78460205-78460227 GGCAATGCAGATGGACCTGTTGG - Intergenic
1043480442 8:80647318-80647340 GGCACTGCAGAAAAAGGGGTGGG + Intronic
1047950750 8:129932777-129932799 GGCCCTGCAGACTGAGTTCTGGG + Intronic
1049641655 8:143718738-143718760 CGCACTGCAGTCGGGGGTGGGGG - Intronic
1051199228 9:14598153-14598175 GGCACTGCAGTAGTAGGTCTAGG - Intergenic
1053137453 9:35660330-35660352 GGCTCTGGAGACTGAGGTGATGG + Exonic
1054174886 9:61868364-61868386 GGGACTGCAGACCCAGGTGCGGG + Intergenic
1054662653 9:67712429-67712451 GGGACTGCAGACCCAGGTGCGGG - Intergenic
1055885961 9:81063476-81063498 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1056239796 9:84633316-84633338 GGCATTGCAGACGCATGTTTGGG + Intergenic
1058727121 9:107814864-107814886 GGAACTGCAGGAGAAGGTGTAGG + Intergenic
1061714724 9:132511469-132511491 GGCACTGGGGAAGGAGGAGTGGG - Intronic
1061716626 9:132522299-132522321 GACACTGCAGCCGGAAGGGTGGG + Intronic
1061902961 9:133682214-133682236 GGCACTGGAGACGCAGCTGAGGG + Intronic
1061904360 9:133689065-133689087 GGCACTCCAGCCAGAGGTCTCGG + Intronic
1062118395 9:134821285-134821307 GGCATTGCTGATGAAGGTGTCGG + Intronic
1062133964 9:134914973-134914995 GTGACTGCAGATGGAGGTGAGGG + Intronic
1062320819 9:135989843-135989865 GGGACTGCAGAGGCAGCTGTGGG + Intergenic
1189945295 X:46171416-46171438 GGCAGTGCAGAAGGAAATGTGGG - Intergenic
1192338037 X:70238277-70238299 GGCATTGTAGTGGGAGGTGTGGG + Exonic
1195154564 X:102110151-102110173 GGCAGTGCAGAAGGAAATGTGGG + Intergenic
1195678275 X:107524019-107524041 GGCTCTGCAGACTGTGGCGTGGG - Intronic
1197314997 X:124954796-124954818 GGAACTGTAGATGGAGATGTGGG - Intronic
1197341045 X:125266645-125266667 GGCAGTGCAGAGGGAAATGTGGG + Intergenic
1197472706 X:126882790-126882812 GGCACTGCCTAGGGAGTTGTGGG + Intergenic
1198369348 X:135974668-135974690 GGCACTGCAGAAGGAGGCAAGGG + Intergenic
1200079069 X:153566603-153566625 CCCACTGCAGAGGGTGGTGTTGG - Intronic
1200167663 X:154048393-154048415 GGCTCTGCAGAAGCAGATGTTGG + Intronic
1200445477 Y:3256137-3256159 GGCACTGCAAAGGGAAATGTGGG - Intergenic