ID: 1132641468

View in Genome Browser
Species Human (GRCh38)
Location 16:980446-980468
Sequence GACCAGCTCCTTCTGCCGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132641464_1132641468 10 Left 1132641464 16:980413-980435 CCCCGACTTTGCATCTGGACTTT 0: 1
1: 0
2: 2
3: 15
4: 108
Right 1132641468 16:980446-980468 GACCAGCTCCTTCTGCCGACCGG 0: 1
1: 0
2: 1
3: 5
4: 98
1132641463_1132641468 11 Left 1132641463 16:980412-980434 CCCCCGACTTTGCATCTGGACTT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1132641468 16:980446-980468 GACCAGCTCCTTCTGCCGACCGG 0: 1
1: 0
2: 1
3: 5
4: 98
1132641465_1132641468 9 Left 1132641465 16:980414-980436 CCCGACTTTGCATCTGGACTTTT 0: 1
1: 1
2: 1
3: 31
4: 221
Right 1132641468 16:980446-980468 GACCAGCTCCTTCTGCCGACCGG 0: 1
1: 0
2: 1
3: 5
4: 98
1132641466_1132641468 8 Left 1132641466 16:980415-980437 CCGACTTTGCATCTGGACTTTTC 0: 1
1: 0
2: 2
3: 17
4: 282
Right 1132641468 16:980446-980468 GACCAGCTCCTTCTGCCGACCGG 0: 1
1: 0
2: 1
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132641468 Original CRISPR GACCAGCTCCTTCTGCCGAC CGG Intronic
900706886 1:4086543-4086565 GCCCAGCTCCTGCAGCCCACGGG - Intergenic
901470122 1:9450221-9450243 TACCAGCTCCTCCTGCCTAAAGG - Intergenic
903043828 1:20551882-20551904 GAAAAGCTCCTTCTGGCGAAAGG - Intergenic
904363131 1:29991325-29991347 TACCAGCTCCGAATGCCGACAGG - Intergenic
904863468 1:33558005-33558027 GACCAGCTCACCCTCCCGACAGG - Intronic
910985624 1:93002283-93002305 GACTACCTCCTTCTGGCGTCTGG + Intergenic
913315694 1:117549483-117549505 GGCCAGCTGCTTCTGCCAAGTGG - Intergenic
915721918 1:157992343-157992365 GACCAGATACTTCTGCTCACAGG - Intergenic
921163729 1:212491108-212491130 GACCAGCACCCTCTGCCCTCGGG - Intergenic
924624440 1:245687614-245687636 GTCCGGCTCCTCCTGCCGGCTGG - Exonic
1065240505 10:23699147-23699169 GATCAGGTCCTTCTGAGGACAGG + Intronic
1070770699 10:79080766-79080788 GACCCACTCCTTCTGCCTAAAGG - Intronic
1076696466 10:132249655-132249677 GCCCAGCTCCTGCTGCCCCCAGG + Intronic
1076815553 10:132913096-132913118 CACCAGCTCCTTCTGCCGCCCGG + Exonic
1077497039 11:2891431-2891453 GACCAGCATCTCCTGCCTACGGG + Intronic
1079689521 11:23403997-23404019 GACCACCTCCTTCAGCCAGCTGG - Intergenic
1083485512 11:62981068-62981090 GGTCAGCTCCTTCTGCAGACTGG + Exonic
1083893757 11:65610097-65610119 TACCAGCTCCCTCTCCCCACTGG + Intronic
1083894542 11:65613574-65613596 GGCCAGCTCATCCTGCCCACTGG + Exonic
1083899200 11:65635560-65635582 CACCAGCTCCTGCTGCTGCCCGG - Exonic
1084502200 11:69541378-69541400 CCCCAGCTCCTTCTTCAGACTGG - Intergenic
1090557360 11:127890830-127890852 GACCAGGGCCTGCTGCTGACTGG - Intergenic
1091562829 12:1628052-1628074 GACCAGCTCATTCTGGCTTCTGG + Intronic
1100667046 12:96766438-96766460 GACCAGCTCCTCCTGGCTGCTGG - Intronic
1102910829 12:116712760-116712782 CTCCAGATCCTTCTGCAGACAGG + Exonic
1105873762 13:24535410-24535432 GGCCAGCTCCTTCTGCCTTTTGG + Intergenic
1105898740 13:24739800-24739822 GTCCAGTTCCTTCTGCCTAGGGG + Intergenic
1113630601 13:111880444-111880466 GCCCCGCTCCATCTGCCTACAGG - Intergenic
1113814356 13:113161261-113161283 GAGCAGCTCCTCCAGCCGCCTGG + Intronic
1121921513 14:97886244-97886266 GCACTGCTCCTTCTGCTGACGGG - Intergenic
1126802696 15:52314328-52314350 GACCAGCTCCTCCTTCCTTCTGG - Intronic
1132641468 16:980446-980468 GACCAGCTCCTTCTGCCGACCGG + Intronic
1136287190 16:29251492-29251514 GCCGAGCTCCTTCTGCAGAAGGG + Intergenic
1138677882 16:58665248-58665270 TTCCAGCTCCTTCTCCTGACTGG + Exonic
1139507794 16:67407953-67407975 GCCCATCTCCCTCTGCCGGCTGG + Intronic
1141470445 16:84234737-84234759 GACCAGCTGCTTCTGGGGACAGG - Intronic
1141703738 16:85653723-85653745 GACCAGCACCTTCGGCCCAGGGG + Intronic
1142092800 16:88224125-88224147 GCCGAGCTCCTTCTGCAGAAGGG + Intergenic
1142522045 17:511825-511847 GACCAGACTCTTCTCCCGACAGG - Exonic
1143114601 17:4575614-4575636 CCCCAGCTCCCTCTCCCGACAGG - Intergenic
1143725169 17:8839584-8839606 GACCAGCTGCTGCTGCCAGCTGG + Intronic
1144506305 17:15834197-15834219 CCCCAGCTCCTTCTGCAGCCAGG - Intergenic
1145170481 17:20652130-20652152 CCCCAGCTCCTTCTGCAGCCAGG - Intergenic
1152923334 17:83076782-83076804 GACCAGCTCCTTCCCACGAGTGG + Intergenic
1154341372 18:13505144-13505166 AACCAGCTCCTACTGCCTAGGGG - Intronic
1163007167 19:14404361-14404383 GACCACCCCCATCTGCCCACAGG + Exonic
1168181454 19:54665141-54665163 GACCAGCCCCTCATGCCTACAGG + Exonic
934765887 2:96879801-96879823 GCCCAGCTCCCTCTGCCTGCCGG + Intronic
936089994 2:109495338-109495360 GACCAGCCCCTCCTGCCCACTGG + Intronic
937044656 2:118844798-118844820 GACCAGCTCCTTCTCCTGCTTGG - Intronic
943718063 2:191173944-191173966 GACCAACTTCTTCTGCCCCCTGG + Intergenic
947713845 2:232330248-232330270 GACCAGCCCTTTCTGGCCACAGG - Intronic
948859235 2:240744934-240744956 GAGCAGCTCCTTCTCCAGGCGGG - Intronic
949014691 2:241702480-241702502 CGCCAGCTCCTCCTGCAGACGGG - Intronic
1172192403 20:33069835-33069857 CTCAAGCTCCTTCTGCCGATTGG + Intronic
1174822189 20:53736360-53736382 GACCAGCTGCTTCTGATGTCGGG - Intergenic
1175240164 20:57541354-57541376 GACCAGCTCCTGCTGTAGCCAGG - Intergenic
1176037260 20:63045665-63045687 AACCTGCCCCTTCTGCCCACTGG - Intergenic
1176238777 20:64066402-64066424 TATCACCTCCTTCTGCCTACTGG - Intronic
1178416967 21:32412360-32412382 GCCGCGCTCCTTCTGCCGCCAGG + Exonic
1183408604 22:37642273-37642295 GACCAAGTCCTACTGCAGACTGG - Intronic
1184814694 22:46860706-46860728 GGCCAGCGTCTTCTGGCGACAGG + Intronic
1184924995 22:47630502-47630524 GACCAGCCCCCTCTGCCTTCTGG + Intergenic
1185148526 22:49151827-49151849 GGCCAGCTCCTCCTGCCTGCTGG + Intergenic
949778860 3:7663301-7663323 GCCCAGTTCCTTGTGCCGAGTGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
950626971 3:14254374-14254396 TACCAGTTCCTTCTGCAGCCTGG - Intergenic
953546688 3:43868768-43868790 GTCCAGCTCCTTCTGTCAACAGG - Intergenic
963836937 3:150067577-150067599 GACCAGCCCCTTCTCCCTTCAGG - Intergenic
973135210 4:46698833-46698855 AACCAGCTCCTTCTGCTTGCAGG + Intergenic
978885120 4:113760237-113760259 AACCACCTCCTTCACCCGACTGG - Intronic
983143219 4:164179159-164179181 CACCAGCTCCTTCTGCTCCCTGG - Intronic
985211936 4:187604539-187604561 GACCAGCTCTGTCTGTTGACAGG - Intergenic
985726719 5:1520050-1520072 GAGCTGCTCCTGCTGCCCACTGG - Intronic
996019157 5:118573145-118573167 ATCCAGCTCATTCTGCTGACAGG - Intergenic
1005966593 6:30730984-30731006 CTCCAGCTCCTTCTCCCGCCGGG + Exonic
1006422426 6:33943643-33943665 GACCAGCTCCTCATCCCAACGGG + Intergenic
1008081776 6:47202800-47202822 GAGCAGCTTGTTCTGCCCACAGG + Intergenic
1009871086 6:69452465-69452487 ACCCAGCTCCTGCTGCAGACTGG - Intergenic
1015317118 6:131829174-131829196 GAACAGCTCTTTCTGCCCTCAGG - Intronic
1018379610 6:163246324-163246346 CACCAGCTCCTTCTTCTGCCTGG + Intronic
1018788887 6:167131057-167131079 TCCCAACTCCTTCTGCCGACAGG + Intronic
1019292147 7:256064-256086 GCCCAGCTCCCTCTGCCGTAGGG - Intronic
1024700327 7:51899509-51899531 CTCCAGCTCCTTCTGCAGGCTGG - Intergenic
1025912359 7:65839081-65839103 GCCCAGCTCCTGCCTCCGACGGG + Intergenic
1026151698 7:67793235-67793257 GACAAGCTCCACCTGCCGTCAGG - Intergenic
1032001352 7:128267551-128267573 GGCCAGCTGCTGCTGCCGCCAGG + Intergenic
1033267756 7:139900722-139900744 TATTAGCTCCTTCTGCAGACCGG + Intronic
1036208775 8:6825307-6825329 CTCCAGTTCCTTCTGCAGACTGG + Exonic
1037579493 8:20236201-20236223 GCCCAGCTCCTCCTACCCACAGG - Intergenic
1039884546 8:41647608-41647630 GGTCAGCTCCTTTTGCTGACTGG + Intronic
1044456043 8:92393943-92393965 GAGCAGCTCCCTCTGCTCACGGG - Intergenic
1048323361 8:133419124-133419146 TATCAGCTCCTTCAACCGACTGG - Intergenic
1052985715 9:34485892-34485914 GACCAGCTCCTTTTGTCTAGAGG - Intronic
1060742760 9:126110502-126110524 GGGCAGCTCCTTCTGCAGAATGG + Intergenic
1061056650 9:128226233-128226255 CAGCAGATCCTTCTGCCCACGGG - Intronic
1061830841 9:133293317-133293339 GACCCCTTCCTTCTCCCGACTGG - Intergenic
1185791664 X:2932026-2932048 CACCAGCTCCTACTGCCCCCAGG - Intergenic
1188078281 X:25805977-25805999 AGCCAGCTCCTTCTGCCAGCTGG - Intergenic
1193201663 X:78698419-78698441 GACCAGCACCTTGTGCTGCCAGG - Intergenic
1198063238 X:133068612-133068634 GACCAAAGCCTTCTGCCTACAGG - Intronic
1199778580 X:151037576-151037598 CAACTGCTCCTTCTGCCCACTGG - Intergenic
1202242426 Y:22785559-22785581 AACCAGCTCCCTCTGCTCACGGG + Intergenic
1202395411 Y:24419308-24419330 AACCAGCTCCCTCTGCTCACGGG + Intergenic
1202475374 Y:25250784-25250806 AACCAGCTCCCTCTGCTCACGGG - Intergenic