ID: 1132641712

View in Genome Browser
Species Human (GRCh38)
Location 16:981165-981187
Sequence GACTCTGGACGAGCTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 236}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132641701_1132641712 26 Left 1132641701 16:981116-981138 CCGAGCCGCGGCCCCTTGAAGCG 0: 1
1: 0
2: 3
3: 9
4: 59
Right 1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 236
1132641704_1132641712 15 Left 1132641704 16:981127-981149 CCCCTTGAAGCGCGTTACCTGGA 0: 1
1: 0
2: 0
3: 5
4: 23
Right 1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 236
1132641705_1132641712 14 Left 1132641705 16:981128-981150 CCCTTGAAGCGCGTTACCTGGAC 0: 1
1: 0
2: 1
3: 1
4: 23
Right 1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 236
1132641707_1132641712 -2 Left 1132641707 16:981144-981166 CCTGGACGTGCGCTGTCCGCAGA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 236
1132641702_1132641712 21 Left 1132641702 16:981121-981143 CCGCGGCCCCTTGAAGCGCGTTA 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 236
1132641706_1132641712 13 Left 1132641706 16:981129-981151 CCTTGAAGCGCGTTACCTGGACG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132641712 Original CRISPR GACTCTGGACGAGCTGGGCC TGG Intronic
900013647 1:135340-135362 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900014411 1:138306-138328 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900043717 1:491323-491345 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900044276 1:493508-493530 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900065155 1:726326-726348 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900065684 1:728414-728436 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
901017498 1:6240400-6240422 CACTCTCCCCGAGCTGGGCCAGG + Intergenic
901080409 1:6580693-6580715 CACTCTGGACGTGGGGGGCCTGG + Exonic
901219111 1:7572947-7572969 GTTTCTGGAAGAGCTGGGGCTGG - Intronic
901241077 1:7693825-7693847 GACTCTGGAGGAGCTGGAGAGGG - Intronic
902090421 1:13898554-13898576 CACCCTCCACGAGCTGGGCCTGG - Intergenic
902274390 1:15328817-15328839 GACTCTGGAGGAGCAGGGACGGG + Intronic
902275587 1:15337166-15337188 GACCCTGGATGGGCTGGGCTGGG + Intronic
903221846 1:21873668-21873690 GACTCTGGCCTGGCTGGGGCAGG + Intronic
906107090 1:43301028-43301050 CAGCCAGGACGAGCTGGGCCTGG - Exonic
915129852 1:153688606-153688628 GTGTCTGGAGGAACTGGGCCTGG - Intronic
915235675 1:154479216-154479238 GACTCAGGAAGAGATGGGCCAGG + Intronic
915595275 1:156893503-156893525 GACTCTGCGCGGCCTGGGCCAGG - Intergenic
915901275 1:159848251-159848273 GAATCTGGAGGAGCTGGGCGTGG - Intronic
918074786 1:181161756-181161778 GACACCAGACGAGCTGGGCTGGG + Intergenic
920694964 1:208174994-208175016 GCCTCTGGGGGAGCTGGGACAGG + Intronic
921095585 1:211884742-211884764 GACTCTGGAAGTGCTGGGGAAGG + Intergenic
921850564 1:219928608-219928630 GACTCTGGACGTGCGGGGACTGG - Intronic
922100060 1:222472335-222472357 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922100265 1:222473163-222473185 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922100466 1:222473963-222473985 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922262084 1:223951801-223951823 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922572486 1:226642286-226642308 GACTCTGTTCCAGCTGGGGCTGG + Intronic
922734184 1:227970777-227970799 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
922734980 1:227973913-227973935 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
924343258 1:243054000-243054022 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
924343729 1:243055880-243055902 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1065882254 10:30046964-30046986 GCCTCTCGAATAGCTGGGCCAGG - Intronic
1066733234 10:38451592-38451614 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1067567483 10:47349402-47349424 GACTCCGGCCGAGCAGGCCCTGG + Exonic
1067675179 10:48368528-48368550 GACTCTGGATGATTTGGCCCTGG - Intronic
1067850159 10:49749648-49749670 GACTGTGGAGGGGCTGAGCCGGG - Intronic
1069537478 10:69265615-69265637 GATTCTGCAGCAGCTGGGCCTGG + Exonic
1069880651 10:71590708-71590730 AAGTCTGTAGGAGCTGGGCCTGG + Intronic
1069957951 10:72063064-72063086 GTGTGTGGACCAGCTGGGCCTGG - Exonic
1073643594 10:105277158-105277180 GTCTCTGGACTACCTGAGCCTGG + Intergenic
1075477977 10:122753058-122753080 GCCTCTGGAGGAGCTGAGTCAGG + Intergenic
1076168446 10:128300884-128300906 GGCCTTGGATGAGCTGGGCCAGG + Intergenic
1076969991 11:127554-127576 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1076970608 11:129983-130005 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1077865576 11:6218617-6218639 TGCTCTGGACGAGGTGGGCTGGG + Exonic
1078438867 11:11347711-11347733 GAGTTTGGAGGAGCTGGGCCAGG - Intronic
1079098505 11:17526572-17526594 GTGTCTGCACCAGCTGGGCCTGG + Intronic
1081181980 11:39995026-39995048 GACTTTGGAACAGCTGGGCACGG + Intergenic
1081537521 11:44006237-44006259 GAGTCTGGGTGATCTGGGCCTGG + Intergenic
1082260225 11:50072480-50072502 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1083205987 11:61149602-61149624 GACTCTGAAAGAGCTGATCCTGG + Intronic
1083747388 11:64743629-64743651 GCCTGTGGACAAGCTGAGCCGGG - Intronic
1083777715 11:64902374-64902396 GACTCTCCGAGAGCTGGGCCAGG + Exonic
1084212071 11:67628969-67628991 AACCCGGGAGGAGCTGGGCCTGG - Exonic
1084793535 11:71489875-71489897 GACTGTGGAAGGGCTTGGCCTGG + Intronic
1089619047 11:119712106-119712128 GGCTCTGGACAAGTTGGGCTTGG + Intronic
1091594071 12:1864030-1864052 GTCTTTGGACGGGATGGGCCCGG - Intronic
1092342770 12:7690585-7690607 GACATTGGCCCAGCTGGGCCTGG - Exonic
1096493129 12:52023717-52023739 GACGGTGGACGGGCTGGGCCGGG - Intronic
1096548221 12:52356014-52356036 GAGTCTGGGGGAGCAGGGCCTGG + Intergenic
1097008899 12:55938619-55938641 GACCCTGGAAGAGTTGGGGCAGG - Intronic
1097350736 12:58545861-58545883 GACTCTGAAGGTGCTGGCCCAGG - Intronic
1103695108 12:122808885-122808907 GAATCTGGAGCAGCTGGGACCGG - Intronic
1104325163 12:127788905-127788927 GACTCTGGCTGTGATGGGCCAGG + Intergenic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1108617596 13:52149364-52149386 AAGTCTGGAGGAGCTGGGCCTGG - Intronic
1110347362 13:74464265-74464287 GAATCTGGAAGATCTGTGCCTGG + Intergenic
1113787710 13:113011350-113011372 GCCTCTGGACTCTCTGGGCCAGG - Intronic
1114353314 14:21878705-21878727 GACTCTGGGCAAGCAGGCCCAGG - Intergenic
1114653382 14:24300691-24300713 GACCCTGGAGGAGCTGGTCCTGG + Exonic
1119300746 14:73569591-73569613 CACTCTTGGCGAGCTGGACCTGG + Exonic
1119861102 14:77936718-77936740 GGCTCTGGACCAAATGGGCCAGG - Intergenic
1119909333 14:78335427-78335449 GACTCTGCCCAAGCTGAGCCAGG + Intronic
1122262345 14:100530669-100530691 GAGCCTGGAGGAGCTGGGCTGGG + Intergenic
1122294087 14:100695206-100695228 GGCTCTGGGCCAGCTGTGCCAGG + Intergenic
1122825721 14:104369534-104369556 GACCCTGGTGGGGCTGGGCCTGG - Intergenic
1124291347 15:28456067-28456089 GGTGCTGGACCAGCTGGGCCAGG - Intergenic
1128075741 15:64824251-64824273 GGCTGTGGAGGAGCTGAGCCCGG - Exonic
1128498263 15:68210442-68210464 GACCCTGGACCAGCTGAGCCAGG + Intronic
1128539396 15:68515873-68515895 AGCTCTGGATGAGCTGGGCAGGG - Intergenic
1129049703 15:72770325-72770347 GTCTCTGGAGTAGCTGGTCCTGG - Intronic
1129330728 15:74826006-74826028 GATGCTGGCTGAGCTGGGCCAGG - Intergenic
1130023708 15:80252139-80252161 GACTCCTGCCGAGCCGGGCCTGG - Intergenic
1132409615 15:101566980-101567002 CACACTGGAGGAGCTGGACCTGG + Intergenic
1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG + Intronic
1132855395 16:2042586-2042608 GTTTCTGGACTGGCTGGGCCCGG + Intronic
1134487459 16:14669878-14669900 GGCTTTGGCAGAGCTGGGCCTGG + Intergenic
1136498586 16:30658734-30658756 GAGGCTGGAGGAGCTGGGCCCGG + Exonic
1136587207 16:31194407-31194429 GCCTCTGGAGTAGCTGGGACGGG + Exonic
1136598106 16:31265740-31265762 GGCTGTGGAAGAGCTGGGCAGGG - Intronic
1136609366 16:31356962-31356984 GGCTGTGGAAGAGCTGGGCAGGG - Intronic
1139346705 16:66308336-66308358 GACTAGGGAAGTGCTGGGCCCGG - Intergenic
1139650405 16:68359384-68359406 GACTCTGGAGGGGCAGGGCTTGG + Exonic
1141091311 16:81132139-81132161 GGCTTTTGACCAGCTGGGCCGGG + Intergenic
1141357071 16:83357158-83357180 GAGTCTGGATGTGATGGGCCAGG - Intronic
1141572883 16:84944927-84944949 GACTCTGAATGGGCTGGACCAGG + Intergenic
1141715455 16:85724389-85724411 GACTCTGGACTTGCTGGGTTGGG + Intronic
1141815951 16:86409329-86409351 GACTCTGGGTGGGCTGTGCCTGG + Intergenic
1141821019 16:86445822-86445844 AACTCTGGAGGTGCTGGGCTTGG - Intergenic
1142032632 16:87846135-87846157 CACTCCGGACAACCTGGGCCTGG - Intronic
1142449640 16:90167499-90167521 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1142450688 16:90171578-90171600 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1142456877 17:62113-62135 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1142457447 17:64346-64368 GAGGCCGGAGGAGCTGGGCCTGG + Intergenic
1142810167 17:2392360-2392382 AGCTCTTGAGGAGCTGGGCCCGG - Intronic
1143019648 17:3910552-3910574 GACACTGGAGGAGCTGGGACAGG + Intronic
1143568141 17:7737640-7737662 GGCTCTTGAGGAGCAGGGCCTGG + Intronic
1144203727 17:12964427-12964449 GAGCCTGGACAAGCTGGGCCAGG + Intronic
1146414640 17:32620552-32620574 GACTCTGGAGGAACTTGGCAGGG - Intronic
1148338729 17:46860337-46860359 GGCTCAGGAGGAGGTGGGCCAGG + Intronic
1149506122 17:57195332-57195354 GACTCTGGATAGGCTGGGCATGG - Intergenic
1151623442 17:75261626-75261648 GAGTCTGCACGAGCTGAGACGGG + Exonic
1152256782 17:79244568-79244590 CACTCTGGGCTTGCTGGGCCTGG + Intronic
1152263325 17:79278830-79278852 GTCACTGGAGGGGCTGGGCCAGG - Intronic
1152403746 17:80084832-80084854 GACCCTGGTGGAGCTGGACCAGG + Exonic
1157684343 18:49630627-49630649 GAGTCTGGGCCAGCTAGGCCTGG - Intergenic
1159080158 18:63727260-63727282 GACTAGGGACCAGGTGGGCCAGG - Intergenic
1160317269 18:77859507-77859529 GTCTCAGGAGGAGCTGGGCGGGG - Intergenic
1160511441 18:79455650-79455672 GGCTCTGGATGTGCTGGGCTGGG - Intronic
1160646789 19:197472-197494 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1161163224 19:2772059-2772081 CACTATGCACGGGCTGGGCCCGG - Intronic
1161200333 19:3011068-3011090 GTGACTGGCCGAGCTGGGCCCGG + Exonic
1161589620 19:5123444-5123466 GACACTGGCCACGCTGGGCCTGG + Intronic
1162019916 19:7863705-7863727 GACTCCGGGCGCGCTGGGCATGG - Intronic
1163272336 19:16261831-16261853 GCCCTTGGGCGAGCTGGGCCAGG - Intergenic
1163875055 19:19860922-19860944 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1163875735 19:19866117-19866139 GACTGAGGCCGAGCTGGGCAGGG - Intronic
1163906261 19:20151663-20151685 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1163948821 19:20565494-20565516 GACTGAGGCCGAGCTGGGCAAGG + Intronic
1164005230 19:21142308-21142330 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164026676 19:21359265-21359287 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164030288 19:21397390-21397412 GACTGAGGCCGAGCTGGGCAAGG - Intronic
1164061485 19:21679296-21679318 GAGTGAGGATGAGCTGGGCCAGG - Intergenic
1164241719 19:23395181-23395203 GACTGAGGCCGAGCTGGGCAAGG + Intronic
1164254144 19:23512370-23512392 GACTGAGGCCGAGCTGGGCAAGG + Intergenic
1164937712 19:32228043-32228065 GTCACTGCACGAGCTGTGCCTGG + Intergenic
1165170261 19:33887438-33887460 GACCCTGGCTGAGCTGAGCCGGG + Intergenic
1165256674 19:34580455-34580477 GGCTGTGGAGGAGCTGGGGCAGG + Intergenic
1165265910 19:34663934-34663956 GGCTGTGGAGGAGCTGGGGCAGG - Intronic
1165273545 19:34730951-34730973 GGCTGTGGAGGAGCTGGGGCAGG - Intergenic
1166142639 19:40813263-40813285 GACTCTGGCCTGGATGGGCCAGG + Intronic
1166917324 19:46204295-46204317 CTTTCTGGACGAGCTGGGCCTGG + Intergenic
1167469709 19:49668847-49668869 AAGTCTGGAGTAGCTGGGCCTGG - Exonic
1167718221 19:51158192-51158214 GATCCTGGATGAGATGGGCCAGG - Intergenic
1168703620 19:58455667-58455689 GACCTGGGACGAGCTGGGCGAGG + Exonic
1168706128 19:58471215-58471237 GACCTGGGACGAGCTGGGCGAGG + Exonic
929962461 2:46506950-46506972 GGCTCTGGAGGGACTGGGCCTGG - Intronic
932667248 2:73707909-73707931 TGCTCTGGACTAGCAGGGCCAGG - Intergenic
934764059 2:96870404-96870426 GACTCCGGGCGGGCTGGGCTGGG + Intronic
937283606 2:120736474-120736496 GGCTCTGGACGAGCAGGGCGGGG + Intronic
940052525 2:149479522-149479544 GACACTAGACGAGGTGAGCCTGG - Intergenic
941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG + Intergenic
942518820 2:176781657-176781679 GACCCTGGAAGAGCTGGACAAGG + Intergenic
942704018 2:178747603-178747625 CACTCTGGACAAGCTTTGCCTGG + Intronic
947890849 2:233617950-233617972 CACTCTGGAGGATCTGGACCGGG + Exonic
948462532 2:238137259-238137281 GACTATGGCTGAGCTGGGCTGGG + Intergenic
948894435 2:240921725-240921747 GACCCTGGAGGAGCCGGGCGGGG - Intronic
1169065898 20:2693909-2693931 CACTCCGGACGGGGTGGGCCGGG - Intronic
1172500948 20:35426897-35426919 GTCTCTGAAATAGCTGGGCCTGG - Intergenic
1173820130 20:46014170-46014192 GCGTCTGGACAAGCTGGGCCTGG + Exonic
1176278713 20:64288754-64288776 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1176304074 21:5114300-5114322 GACTGTGGAGGAGCTGGGAGTGG + Intergenic
1178294577 21:31398329-31398351 AACTGTGGATAAGCTGGGCCTGG + Intronic
1179464390 21:41562153-41562175 GAGGCTGGAGGAGCCGGGCCAGG - Intergenic
1179778969 21:43687463-43687485 GACTCTGGCCCAGCTGGCACTGG + Intronic
1181327536 22:22061304-22061326 GAGTGTGGGCGAGCTTGGCCAGG - Intergenic
1181537381 22:23553591-23553613 GACTCTTGGCAAGCAGGGCCTGG + Intergenic
1181902723 22:26169477-26169499 CGCTCTGGCCGAGCTGCGCCGGG - Intronic
1182325748 22:29511394-29511416 GCCTCTGCAGGGGCTGGGCCAGG + Intronic
1183489764 22:38110202-38110224 GAGTCTGGATGAGAAGGGCCTGG - Intronic
1184123390 22:42469008-42469030 GACTCTGAGCAAGCTTGGCCAGG + Intergenic
1185199117 22:49491261-49491283 CAGCCTGGAGGAGCTGGGCCTGG - Intronic
952970038 3:38645003-38645025 GACTCTAGACTGGCTGGGCAGGG - Intronic
953797255 3:45995305-45995327 GTCTCTGGCCCAGTTGGGCCGGG - Intronic
955322712 3:57985781-57985803 GATTCTCGAGGAGCTCGGCCTGG + Intergenic
957335110 3:78818230-78818252 GATGCTGGACAGGCTGGGCCAGG - Intronic
958613107 3:96452673-96452695 GAGTAGGGAAGAGCTGGGCCTGG + Intergenic
959132477 3:102374341-102374363 ATCTATGGAGGAGCTGGGCCAGG - Intronic
960438261 3:117653971-117653993 CACTCTGGCTGAGCTGGGCTTGG + Intergenic
961739199 3:129022229-129022251 GACTCTGTGCTAGCTGGGCCTGG - Intronic
962023764 3:131526786-131526808 AAGTCTGGAGTAGCTGGGCCAGG - Intergenic
964010721 3:151888066-151888088 GACTTGGGCTGAGCTGGGCCTGG + Intergenic
964011536 3:151898305-151898327 GACTTGGGCTGAGCTGGGCCTGG - Intergenic
968370892 3:198222050-198222072 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
969388096 4:6870008-6870030 CACCCTGGGCGAGCTGGGGCAGG + Intronic
975259020 4:72274277-72274299 AATTCTGGACGAGGTGGGCTGGG + Intergenic
975879061 4:78880360-78880382 AACTCTGAAAGAGCTGGGCATGG - Intronic
979259346 4:118633677-118633699 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
979259574 4:118634538-118634560 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
979328800 4:119406086-119406108 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
979329004 4:119406886-119406908 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
983537928 4:168878019-168878041 GAGGCTGGACGAGCTGGGGCTGG - Intronic
985557850 5:566140-566162 TACTCTAGCAGAGCTGGGCCAGG + Intergenic
985867421 5:2524732-2524754 AGCTCTGGACAAGCTGGTCCTGG + Intergenic
988718314 5:33850650-33850672 TACTCTGGATGACCTGGGCTAGG + Intronic
990417962 5:55604948-55604970 GACCCGGGAGGTGCTGGGCCCGG + Intergenic
997329971 5:133052700-133052722 GACTCAGTACGACCTGGGCCTGG - Intronic
997759581 5:136432386-136432408 GACTCTGGTAGAACTGGTCCAGG - Intergenic
998353436 5:141515712-141515734 TTCTCTGGTTGAGCTGGGCCAGG - Exonic
999374997 5:151080812-151080834 GGCTCTGGACGATCTGGGCCTGG + Intronic
1002698239 5:181104357-181104379 GCCTCTGGAGTAGCTGCGCCTGG + Intergenic
1002729567 5:181325421-181325443 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1002730126 5:181327606-181327628 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1002754406 6:146493-146515 GAGGCAGGAGGAGCTGGGCCCGG + Intergenic
1005958217 6:30679305-30679327 GGTACTGGAGGAGCTGGGCCCGG - Exonic
1006267912 6:32940842-32940864 GACCCTGGAAGAGCTGGTCCAGG - Exonic
1007636084 6:43300584-43300606 GGCTATGGAGGACCTGGGCCTGG + Intronic
1009716846 6:67408617-67408639 GACTTTGGAGGAACAGGGCCAGG - Intergenic
1010404383 6:75486345-75486367 CACCCTGGATGAGCTAGGCCTGG - Intronic
1016389129 6:143557602-143557624 GAGTCTGGAAGAGCTGGACCAGG - Intronic
1016723715 6:147333800-147333822 GAGTTTGGACTAGCTGGGCAAGG - Intronic
1017197719 6:151719566-151719588 GACTCAGGAGGTGCTGGGGCAGG + Intronic
1018524964 6:164699534-164699556 GAAAATGCACGAGCTGGGCCCGG - Intergenic
1018792398 6:167158516-167158538 GGATCTGGACCAGCAGGGCCTGG + Intronic
1019538051 7:1538987-1539009 CCCTCAGGACGGGCTGGGCCCGG + Intronic
1019739521 7:2665795-2665817 GGCTCAGGAAGAGCTCGGCCCGG - Intergenic
1021774407 7:24038223-24038245 GACAGTGGCAGAGCTGGGCCTGG + Intergenic
1022536573 7:31102245-31102267 TCCTCTGGAGGAGATGGGCCAGG + Intronic
1023400791 7:39792208-39792230 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1023401299 7:39794164-39794186 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024074256 7:45810723-45810745 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024075285 7:45814806-45814828 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024648314 7:51386517-51386539 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1024648845 7:51388590-51388612 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1025053156 7:55744805-55744827 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1025181930 7:56827728-56827750 GAGACAGGAGGAGCTGGGCCTGG + Intergenic
1026953409 7:74362175-74362197 GACTCTGGCCGACTTGGTCCTGG + Intronic
1026972102 7:74474779-74474801 GCCTCAGGGCTAGCTGGGCCTGG - Intronic
1029226766 7:99034154-99034176 GAGTCAGGACAGGCTGGGCCAGG + Intronic
1029477358 7:100792819-100792841 GACCCTGGATGGGCTGGGCGTGG + Intronic
1029495633 7:100894553-100894575 CTCACTGCACGAGCTGGGCCCGG - Intronic
1032051288 7:128652542-128652564 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1032051799 7:128654529-128654551 GAGGCAGGAAGAGCTGGGCCTGG - Intergenic
1032732898 7:134661714-134661736 GATCCTGGAAGAGCTAGGCCAGG + Exonic
1033546832 7:142408929-142408951 GCCTCTGAACTAGCTGGCCCAGG - Intergenic
1034276651 7:149826756-149826778 GACCCTGGAAGAGCAGGCCCAGG + Intergenic
1035277089 7:157754138-157754160 GGCTCAGGAAGAGCAGGGCCTGG + Intronic
1036082481 8:5572792-5572814 AACTCTGGGGGAGCTAGGCCGGG + Intergenic
1036560349 8:9896503-9896525 GCCTCTGGACAAGCTAGGCAGGG + Intergenic
1038575840 8:28702295-28702317 GGCTCTAGGGGAGCTGGGCCTGG - Intronic
1043281759 8:78476527-78476549 GACTTTGGATTAGCTGGGCCTGG + Intergenic
1045584219 8:103513156-103513178 TGCTCTGGGTGAGCTGGGCCAGG + Intronic
1047808682 8:128384292-128384314 GAGTCTGGAAGAGATGAGCCTGG + Intergenic
1049199549 8:141333317-141333339 GAGGCTGGAGGGGCTGGGCCTGG + Intergenic
1049453940 8:142677594-142677616 GAGTCCGGGCGAGCTGGGGCGGG + Intronic
1049670723 8:143868606-143868628 GACGCTGGACGAGCTGAGCCAGG - Exonic
1049775115 8:144400542-144400564 TGCTCGGGAGGAGCTGGGCCTGG - Intronic
1059698887 9:116756134-116756156 GGCTGTGGACGAGGAGGGCCTGG - Intronic
1060291882 9:122310642-122310664 GCCTCTGGAAAAGGTGGGCCAGG + Intronic
1060437195 9:123604113-123604135 GGCCCTGGATGGGCTGGGCCTGG + Intronic
1061363187 9:130156727-130156749 GACCCTGGGAGAACTGGGCCAGG + Intergenic
1061631028 9:131872242-131872264 GACTGTGGCCGAGCAGCGCCTGG + Intronic
1062204175 9:135326545-135326567 GACTTAGGACAAGGTGGGCCAGG + Intergenic
1062312261 9:135945158-135945180 GCCTCTGGGGGAGCTTGGCCAGG + Exonic
1062754541 9:138280120-138280142 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203577538 Un_KI270745v1:20690-20712 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203578443 Un_KI270745v1:24280-24302 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1192274734 X:69616877-69616899 GAGTCTGGATTAGCTGGGCCAGG - Intronic
1202381081 Y:24276906-24276928 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1202489704 Y:25393220-25393242 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic