ID: 1132642406

View in Genome Browser
Species Human (GRCh38)
Location 16:983861-983883
Sequence TCCGACTCGGGCGCGGAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132642397_1132642406 16 Left 1132642397 16:983822-983844 CCACGGCGCAGGAAGAGCGCCAA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1132642406 16:983861-983883 TCCGACTCGGGCGCGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1132642396_1132642406 20 Left 1132642396 16:983818-983840 CCAGCCACGGCGCAGGAAGAGCG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1132642406 16:983861-983883 TCCGACTCGGGCGCGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1132642399_1132642406 -3 Left 1132642399 16:983841-983863 CCAAAGCCGGCCACAGCGACTCC 0: 1
1: 0
2: 1
3: 2
4: 110
Right 1132642406 16:983861-983883 TCCGACTCGGGCGCGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1132642400_1132642406 -9 Left 1132642400 16:983847-983869 CCGGCCACAGCGACTCCGACTCG 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1132642406 16:983861-983883 TCCGACTCGGGCGCGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132642406 Original CRISPR TCCGACTCGGGCGCGGAGCT GGG Exonic