ID: 1132645447

View in Genome Browser
Species Human (GRCh38)
Location 16:997363-997385
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132645436_1132645447 29 Left 1132645436 16:997311-997333 CCTCAGGCATTTTAGGGAAGAGG No data
Right 1132645447 16:997363-997385 TCTCCCTGGGCCCCCGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132645447 Original CRISPR TCTCCCTGGGCCCCCGAGGG AGG Intergenic
No off target data available for this crispr