ID: 1132645707

View in Genome Browser
Species Human (GRCh38)
Location 16:998403-998425
Sequence GGCTCTGGGCGCCACCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132645707_1132645712 -5 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645712 16:998421-998443 GAGCCAGCTGGAGAGGCCCACGG No data
1132645707_1132645715 -1 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645715 16:998425-998447 CAGCTGGAGAGGCCCACGGGAGG No data
1132645707_1132645721 22 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645721 16:998448-998470 CGTGAAGGCTGCTGGGTGCCAGG No data
1132645707_1132645719 14 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645719 16:998440-998462 ACGGGAGGCGTGAAGGCTGCTGG No data
1132645707_1132645716 7 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645716 16:998433-998455 GAGGCCCACGGGAGGCGTGAAGG No data
1132645707_1132645713 -4 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645713 16:998422-998444 AGCCAGCTGGAGAGGCCCACGGG No data
1132645707_1132645720 15 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645720 16:998441-998463 CGGGAGGCGTGAAGGCTGCTGGG No data
1132645707_1132645722 23 Left 1132645707 16:998403-998425 CCAGGCAGGTGGCGCCCAGAGCC No data
Right 1132645722 16:998449-998471 GTGAAGGCTGCTGGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132645707 Original CRISPR GGCTCTGGGCGCCACCTGCC TGG (reversed) Intergenic
No off target data available for this crispr