ID: 1132645962

View in Genome Browser
Species Human (GRCh38)
Location 16:999410-999432
Sequence GACAGTGACCATGGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132645962_1132645964 -7 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645964 16:999426-999448 CACTGTCAGTAATCACTGTGAGG No data
1132645962_1132645966 -5 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645966 16:999428-999450 CTGTCAGTAATCACTGTGAGGGG No data
1132645962_1132645968 -1 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645968 16:999432-999454 CAGTAATCACTGTGAGGGGTGGG No data
1132645962_1132645965 -6 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645965 16:999427-999449 ACTGTCAGTAATCACTGTGAGGG No data
1132645962_1132645967 -2 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645967 16:999431-999453 TCAGTAATCACTGTGAGGGGTGG No data
1132645962_1132645970 9 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645970 16:999442-999464 TGTGAGGGGTGGGACTGCGTGGG No data
1132645962_1132645969 8 Left 1132645962 16:999410-999432 CCTTCAAGGCCATGGTCACTGTC No data
Right 1132645969 16:999441-999463 CTGTGAGGGGTGGGACTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132645962 Original CRISPR GACAGTGACCATGGCCTTGA AGG (reversed) Intergenic
No off target data available for this crispr