ID: 1132645976

View in Genome Browser
Species Human (GRCh38)
Location 16:999476-999498
Sequence ACGGAGGAACAGCCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132645976_1132645987 18 Left 1132645976 16:999476-999498 CCATCCCCAGGCTGTTCCTCCGT No data
Right 1132645987 16:999517-999539 GGTGCCTCATGCCAGGCACACGG No data
1132645976_1132645983 -3 Left 1132645976 16:999476-999498 CCATCCCCAGGCTGTTCCTCCGT No data
Right 1132645983 16:999496-999518 CGTGAGGTCACAACTGACCCTGG No data
1132645976_1132645984 11 Left 1132645976 16:999476-999498 CCATCCCCAGGCTGTTCCTCCGT No data
Right 1132645984 16:999510-999532 TGACCCTGGTGCCTCATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132645976 Original CRISPR ACGGAGGAACAGCCTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr