ID: 1132647656

View in Genome Browser
Species Human (GRCh38)
Location 16:1006589-1006611
Sequence TCTTGGGACTGAAGGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132647639_1132647656 29 Left 1132647639 16:1006537-1006559 CCCAGCCCCCAGCACCAGGGGAG No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647646_1132647656 21 Left 1132647646 16:1006545-1006567 CCAGCACCAGGGGAGGGCTCTGT No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647638_1132647656 30 Left 1132647638 16:1006536-1006558 CCCCAGCCCCCAGCACCAGGGGA No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647640_1132647656 28 Left 1132647640 16:1006538-1006560 CCAGCCCCCAGCACCAGGGGAGG No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647645_1132647656 22 Left 1132647645 16:1006544-1006566 CCCAGCACCAGGGGAGGGCTCTG No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647643_1132647656 24 Left 1132647643 16:1006542-1006564 CCCCCAGCACCAGGGGAGGGCTC No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647648_1132647656 15 Left 1132647648 16:1006551-1006573 CCAGGGGAGGGCTCTGTGCTGGG No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data
1132647644_1132647656 23 Left 1132647644 16:1006543-1006565 CCCCAGCACCAGGGGAGGGCTCT No data
Right 1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132647656 Original CRISPR TCTTGGGACTGAAGGGACAC TGG Intergenic
No off target data available for this crispr