ID: 1132649987

View in Genome Browser
Species Human (GRCh38)
Location 16:1016264-1016286
Sequence CAAGGTCACCAGTTGATACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132649987_1132649996 22 Left 1132649987 16:1016264-1016286 CCGTGTATCAACTGGTGACCTTG No data
Right 1132649996 16:1016309-1016331 TACATAGCCCTCCTCCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132649987 Original CRISPR CAAGGTCACCAGTTGATACA CGG (reversed) Intergenic
No off target data available for this crispr