ID: 1132650176

View in Genome Browser
Species Human (GRCh38)
Location 16:1017659-1017681
Sequence TCACGCACTGCTGGCAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132650176_1132650181 18 Left 1132650176 16:1017659-1017681 CCATTCCTGCCAGCAGTGCGTGA No data
Right 1132650181 16:1017700-1017722 CCTCACCAACACCTACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132650176 Original CRISPR TCACGCACTGCTGGCAGGAA TGG (reversed) Intergenic
No off target data available for this crispr