ID: 1132652440

View in Genome Browser
Species Human (GRCh38)
Location 16:1027699-1027721
Sequence CGCCCGGCCCGCGTGCGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132652440_1132652446 26 Left 1132652440 16:1027699-1027721 CCTAAGCGCACGCGGGCCGGGCG No data
Right 1132652446 16:1027748-1027770 GACTTCTTTCTCACGGCGGCTGG No data
1132652440_1132652444 19 Left 1132652440 16:1027699-1027721 CCTAAGCGCACGCGGGCCGGGCG No data
Right 1132652444 16:1027741-1027763 AGTGAATGACTTCTTTCTCACGG No data
1132652440_1132652445 22 Left 1132652440 16:1027699-1027721 CCTAAGCGCACGCGGGCCGGGCG No data
Right 1132652445 16:1027744-1027766 GAATGACTTCTTTCTCACGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132652440 Original CRISPR CGCCCGGCCCGCGTGCGCTT AGG (reversed) Intergenic