ID: 1132652440 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:1027699-1027721 |
| Sequence | CGCCCGGCCCGCGTGCGCTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132652440_1132652446 | 26 | Left | 1132652440 | 16:1027699-1027721 | CCTAAGCGCACGCGGGCCGGGCG | No data | ||
| Right | 1132652446 | 16:1027748-1027770 | GACTTCTTTCTCACGGCGGCTGG | No data | ||||
| 1132652440_1132652444 | 19 | Left | 1132652440 | 16:1027699-1027721 | CCTAAGCGCACGCGGGCCGGGCG | No data | ||
| Right | 1132652444 | 16:1027741-1027763 | AGTGAATGACTTCTTTCTCACGG | No data | ||||
| 1132652440_1132652445 | 22 | Left | 1132652440 | 16:1027699-1027721 | CCTAAGCGCACGCGGGCCGGGCG | No data | ||
| Right | 1132652445 | 16:1027744-1027766 | GAATGACTTCTTTCTCACGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132652440 | Original CRISPR | CGCCCGGCCCGCGTGCGCTT AGG (reversed) | Intergenic | ||