ID: 1132653603

View in Genome Browser
Species Human (GRCh38)
Location 16:1032366-1032388
Sequence GACCTGGGGGGTGGTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132653603_1132653612 -7 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653612 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data
1132653603_1132653615 6 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653603_1132653613 -6 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653613 16:1032383-1032405 CAGGTCCAAGGGCAGAGCCAGGG No data
1132653603_1132653623 29 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653603_1132653620 23 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653620 16:1032412-1032434 CCCCGGGACCAGTCCAGTGACGG No data
1132653603_1132653616 7 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653616 16:1032396-1032418 AGAGCCAGGGTGATTCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132653603 Original CRISPR GACCTGGGGGGTGGTTCTAC AGG (reversed) Intergenic
No off target data available for this crispr