ID: 1132653612

View in Genome Browser
Species Human (GRCh38)
Location 16:1032382-1032404
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132653603_1132653612 -7 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653612 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data
1132653597_1132653612 26 Left 1132653597 16:1032333-1032355 CCAGAGCCAGCATTTCGCTTACA No data
Right 1132653612 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data
1132653602_1132653612 -6 Left 1132653602 16:1032365-1032387 CCCTGTAGAACCACCCCCCAGGT No data
Right 1132653612 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data
1132653600_1132653612 20 Left 1132653600 16:1032339-1032361 CCAGCATTTCGCTTACATGGGAT No data
Right 1132653612 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132653612 Original CRISPR CCAGGTCCAAGGGCAGAGCC AGG Intergenic