ID: 1132653615

View in Genome Browser
Species Human (GRCh38)
Location 16:1032395-1032417
Sequence CAGAGCCAGGGTGATTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132653611_1132653615 -10 Left 1132653611 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653608_1132653615 -7 Left 1132653608 16:1032379-1032401 CCCCCAGGTCCAAGGGCAGAGCC No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653606_1132653615 -3 Left 1132653606 16:1032375-1032397 CCACCCCCCAGGTCCAAGGGCAG No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653607_1132653615 -6 Left 1132653607 16:1032378-1032400 CCCCCCAGGTCCAAGGGCAGAGC No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653610_1132653615 -9 Left 1132653610 16:1032381-1032403 CCCAGGTCCAAGGGCAGAGCCAG No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653609_1132653615 -8 Left 1132653609 16:1032380-1032402 CCCCAGGTCCAAGGGCAGAGCCA No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653602_1132653615 7 Left 1132653602 16:1032365-1032387 CCCTGTAGAACCACCCCCCAGGT No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data
1132653603_1132653615 6 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653615 16:1032395-1032417 CAGAGCCAGGGTGATTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132653615 Original CRISPR CAGAGCCAGGGTGATTCCCC CGG Intergenic