ID: 1132653623

View in Genome Browser
Species Human (GRCh38)
Location 16:1032418-1032440
Sequence GACCAGTCCAGTGACGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132653609_1132653623 15 Left 1132653609 16:1032380-1032402 CCCCAGGTCCAAGGGCAGAGCCA No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653607_1132653623 17 Left 1132653607 16:1032378-1032400 CCCCCCAGGTCCAAGGGCAGAGC No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653606_1132653623 20 Left 1132653606 16:1032375-1032397 CCACCCCCCAGGTCCAAGGGCAG No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653617_1132653623 -5 Left 1132653617 16:1032400-1032422 CCAGGGTGATTCCCCCGGGACCA No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653611_1132653623 13 Left 1132653611 16:1032382-1032404 CCAGGTCCAAGGGCAGAGCCAGG No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653602_1132653623 30 Left 1132653602 16:1032365-1032387 CCCTGTAGAACCACCCCCCAGGT No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653614_1132653623 7 Left 1132653614 16:1032388-1032410 CCAAGGGCAGAGCCAGGGTGATT No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653608_1132653623 16 Left 1132653608 16:1032379-1032401 CCCCCAGGTCCAAGGGCAGAGCC No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653610_1132653623 14 Left 1132653610 16:1032381-1032403 CCCAGGTCCAAGGGCAGAGCCAG No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data
1132653603_1132653623 29 Left 1132653603 16:1032366-1032388 CCTGTAGAACCACCCCCCAGGTC No data
Right 1132653623 16:1032418-1032440 GACCAGTCCAGTGACGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132653623 Original CRISPR GACCAGTCCAGTGACGGCCA AGG Intergenic