ID: 1132654945

View in Genome Browser
Species Human (GRCh38)
Location 16:1037830-1037852
Sequence CTCCCAGCACTGATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132654936_1132654945 15 Left 1132654936 16:1037792-1037814 CCATGGAGGGGCCATGTGTAGGG No data
Right 1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG No data
1132654940_1132654945 -9 Left 1132654940 16:1037816-1037838 CCAAGACCTCCTGACTCCCAGCA No data
Right 1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG No data
1132654934_1132654945 25 Left 1132654934 16:1037782-1037804 CCAGACAGCGCCATGGAGGGGCC No data
Right 1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG No data
1132654933_1132654945 26 Left 1132654933 16:1037781-1037803 CCCAGACAGCGCCATGGAGGGGC No data
Right 1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG No data
1132654939_1132654945 4 Left 1132654939 16:1037803-1037825 CCATGTGTAGGGGCCAAGACCTC No data
Right 1132654945 16:1037830-1037852 CTCCCAGCACTGATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132654945 Original CRISPR CTCCCAGCACTGATGGAAGA GGG Intergenic
No off target data available for this crispr