ID: 1132655023

View in Genome Browser
Species Human (GRCh38)
Location 16:1038208-1038230
Sequence CCTTCCAGGGAGCAGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132655023_1132655033 9 Left 1132655023 16:1038208-1038230 CCAGCCCTCTGCTCCCTGGAAGG No data
Right 1132655033 16:1038240-1038262 GGCTGCATTAGGCCCCCGGAAGG No data
1132655023_1132655032 5 Left 1132655023 16:1038208-1038230 CCAGCCCTCTGCTCCCTGGAAGG No data
Right 1132655032 16:1038236-1038258 GTGAGGCTGCATTAGGCCCCCGG No data
1132655023_1132655031 -2 Left 1132655023 16:1038208-1038230 CCAGCCCTCTGCTCCCTGGAAGG No data
Right 1132655031 16:1038229-1038251 GGGCACTGTGAGGCTGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132655023 Original CRISPR CCTTCCAGGGAGCAGAGGGC TGG (reversed) Intergenic
No off target data available for this crispr