ID: 1132655651

View in Genome Browser
Species Human (GRCh38)
Location 16:1040748-1040770
Sequence AGTGAACCCAGGACAACGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132655639_1132655651 4 Left 1132655639 16:1040721-1040743 CCCCAGTAGGAGCCCCCGCCCCA No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data
1132655640_1132655651 3 Left 1132655640 16:1040722-1040744 CCCAGTAGGAGCCCCCGCCCCAG No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data
1132655642_1132655651 -8 Left 1132655642 16:1040733-1040755 CCCCCGCCCCAGCACAGTGAACC No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data
1132655641_1132655651 2 Left 1132655641 16:1040723-1040745 CCAGTAGGAGCCCCCGCCCCAGC No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data
1132655644_1132655651 -10 Left 1132655644 16:1040735-1040757 CCCGCCCCAGCACAGTGAACCCA No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data
1132655643_1132655651 -9 Left 1132655643 16:1040734-1040756 CCCCGCCCCAGCACAGTGAACCC No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data
1132655638_1132655651 12 Left 1132655638 16:1040713-1040735 CCACAGAGCCCCAGTAGGAGCCC No data
Right 1132655651 16:1040748-1040770 AGTGAACCCAGGACAACGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132655651 Original CRISPR AGTGAACCCAGGACAACGTC GGG Intergenic
No off target data available for this crispr