ID: 1132656689

View in Genome Browser
Species Human (GRCh38)
Location 16:1044472-1044494
Sequence CCCCCCAGGCGGCCCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132656689_1132656703 4 Left 1132656689 16:1044472-1044494 CCCGCCCGGGGCCGCCTGGGGGG No data
Right 1132656703 16:1044499-1044521 GGTGGGGCCAGGACAGCTCCGGG No data
1132656689_1132656702 3 Left 1132656689 16:1044472-1044494 CCCGCCCGGGGCCGCCTGGGGGG No data
Right 1132656702 16:1044498-1044520 AGGTGGGGCCAGGACAGCTCCGG No data
1132656689_1132656700 -7 Left 1132656689 16:1044472-1044494 CCCGCCCGGGGCCGCCTGGGGGG No data
Right 1132656700 16:1044488-1044510 TGGGGGGCCGAGGTGGGGCCAGG No data
1132656689_1132656706 22 Left 1132656689 16:1044472-1044494 CCCGCCCGGGGCCGCCTGGGGGG No data
Right 1132656706 16:1044517-1044539 CCGGGCCTCTTCCTCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132656689 Original CRISPR CCCCCCAGGCGGCCCCGGGC GGG (reversed) Intergenic
No off target data available for this crispr