ID: 1132661218

View in Genome Browser
Species Human (GRCh38)
Location 16:1062349-1062371
Sequence CCTTCCTGGCACCCACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132661212_1132661218 -7 Left 1132661212 16:1062333-1062355 CCTTGAGGCCTCGCACCCTTCCT No data
Right 1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG No data
1132661207_1132661218 17 Left 1132661207 16:1062309-1062331 CCGGCTGCAGCTCCGGCCCTGGC No data
Right 1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG No data
1132661205_1132661218 18 Left 1132661205 16:1062308-1062330 CCCGGCTGCAGCTCCGGCCCTGG No data
Right 1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG No data
1132661209_1132661218 5 Left 1132661209 16:1062321-1062343 CCGGCCCTGGCTCCTTGAGGCCT No data
Right 1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG No data
1132661210_1132661218 1 Left 1132661210 16:1062325-1062347 CCCTGGCTCCTTGAGGCCTCGCA No data
Right 1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG No data
1132661211_1132661218 0 Left 1132661211 16:1062326-1062348 CCTGGCTCCTTGAGGCCTCGCAC No data
Right 1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132661218 Original CRISPR CCTTCCTGGCACCCACTGGC TGG Intergenic
No off target data available for this crispr