ID: 1132662456

View in Genome Browser
Species Human (GRCh38)
Location 16:1067672-1067694
Sequence TTGGGTTCAACGGAGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132662449_1132662456 4 Left 1132662449 16:1067645-1067667 CCATGCTGGGGATTGAGGTCCTC No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data
1132662441_1132662456 24 Left 1132662441 16:1067625-1067647 CCTGTCCTGTGGAACCCGGGCCA No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data
1132662438_1132662456 29 Left 1132662438 16:1067620-1067642 CCTGGCCTGTCCTGTGGAACCCG No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data
1132662442_1132662456 19 Left 1132662442 16:1067630-1067652 CCTGTGGAACCCGGGCCATGCTG No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data
1132662447_1132662456 9 Left 1132662447 16:1067640-1067662 CCGGGCCATGCTGGGGATTGAGG No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data
1132662437_1132662456 30 Left 1132662437 16:1067619-1067641 CCCTGGCCTGTCCTGTGGAACCC No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data
1132662446_1132662456 10 Left 1132662446 16:1067639-1067661 CCCGGGCCATGCTGGGGATTGAG No data
Right 1132662456 16:1067672-1067694 TTGGGTTCAACGGAGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132662456 Original CRISPR TTGGGTTCAACGGAGGCTGC GGG Intergenic
No off target data available for this crispr