ID: 1132663164

View in Genome Browser
Species Human (GRCh38)
Location 16:1070507-1070529
Sequence TGAGCATCAGGCGTTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132663164_1132663176 19 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663176 16:1070549-1070571 GGGGCCCTTTGGAGGAGCGGAGG No data
1132663164_1132663168 -9 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663168 16:1070521-1070543 TGATGCTCAGAGGGTGACAGTGG No data
1132663164_1132663172 0 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663172 16:1070530-1070552 GAGGGTGACAGTGGGCAGCGGGG No data
1132663164_1132663175 16 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663175 16:1070546-1070568 AGCGGGGCCCTTTGGAGGAGCGG No data
1132663164_1132663170 -2 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663170 16:1070528-1070550 CAGAGGGTGACAGTGGGCAGCGG No data
1132663164_1132663169 -8 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663169 16:1070522-1070544 GATGCTCAGAGGGTGACAGTGGG No data
1132663164_1132663173 8 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663173 16:1070538-1070560 CAGTGGGCAGCGGGGCCCTTTGG No data
1132663164_1132663171 -1 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663171 16:1070529-1070551 AGAGGGTGACAGTGGGCAGCGGG No data
1132663164_1132663177 20 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663177 16:1070550-1070572 GGGCCCTTTGGAGGAGCGGAGGG No data
1132663164_1132663179 23 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663179 16:1070553-1070575 CCCTTTGGAGGAGCGGAGGGAGG No data
1132663164_1132663174 11 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663174 16:1070541-1070563 TGGGCAGCGGGGCCCTTTGGAGG No data
1132663164_1132663181 24 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132663164 Original CRISPR TGAGCATCAGGCGTTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr