ID: 1132663181

View in Genome Browser
Species Human (GRCh38)
Location 16:1070554-1070576
Sequence CCTTTGGAGGAGCGGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132663164_1132663181 24 Left 1132663164 16:1070507-1070529 CCAGGGCAAACGCCTGATGCTCA No data
Right 1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG No data
1132663167_1132663181 12 Left 1132663167 16:1070519-1070541 CCTGATGCTCAGAGGGTGACAGT No data
Right 1132663181 16:1070554-1070576 CCTTTGGAGGAGCGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132663181 Original CRISPR CCTTTGGAGGAGCGGAGGGA GGG Intergenic
No off target data available for this crispr