ID: 1132665465

View in Genome Browser
Species Human (GRCh38)
Location 16:1079492-1079514
Sequence GGGCTTCTTCGCGCCGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132665461_1132665465 5 Left 1132665461 16:1079464-1079486 CCGTCTTCATCATCTACACGGCC 0: 1
1: 1
2: 0
3: 12
4: 130
Right 1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG 0: 1
1: 1
2: 0
3: 7
4: 89
1132665456_1132665465 30 Left 1132665456 16:1079439-1079461 CCGGAGCCCGTGGGGCTGTGGGG 0: 1
1: 0
2: 11
3: 54
4: 414
Right 1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG 0: 1
1: 1
2: 0
3: 7
4: 89
1132665459_1132665465 23 Left 1132665459 16:1079446-1079468 CCGTGGGGCTGTGGGGCGCCGTC 0: 1
1: 0
2: 4
3: 14
4: 142
Right 1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG 0: 1
1: 1
2: 0
3: 7
4: 89
1132665458_1132665465 24 Left 1132665458 16:1079445-1079467 CCCGTGGGGCTGTGGGGCGCCGT 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG 0: 1
1: 1
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132665465 Original CRISPR GGGCTTCTTCGCGCCGCTGC TGG Exonic
905066847 1:35192094-35192116 GCGCTTGCGCGCGCCGCTGCGGG - Intronic
913291327 1:117274880-117274902 GGGCTTCTTGTCCCAGCTGCTGG - Intergenic
915301167 1:154952422-154952444 GGGCTTCTGTGAGCAGCTGCTGG - Intronic
920564936 1:206965737-206965759 GGCCTTCCTCGCCCCTCTGCTGG - Exonic
1065712575 10:28532545-28532567 CGGCGCCTTCGGGCCGCTGCTGG - Intronic
1070305860 10:75238796-75238818 GGCCTTCTTGGCTCCTCTGCTGG + Intergenic
1075953059 10:126498630-126498652 GAGCTTCTTCCCCCAGCTGCTGG + Intronic
1079195458 11:18322654-18322676 GCGCTTCTTAGAGCCGCTGCTGG - Exonic
1083477543 11:62923796-62923818 GGGCTTCTTGAAGCGGCTGCAGG + Intergenic
1083758453 11:64803331-64803353 GGGCTTCCCCGCGCCGCCGAGGG - Intergenic
1084359029 11:68657561-68657583 GGGCTTGTTCACCCCACTGCCGG - Intergenic
1084539381 11:69776498-69776520 GGGCTTATTCGTGCCCCTGGAGG + Intergenic
1089432753 11:118436842-118436864 GGGCTTCGACGCGGCGCTGCAGG + Exonic
1090699309 11:129279614-129279636 GCGCCTCTTCTCCCCGCTGCGGG - Intergenic
1091823365 12:3492202-3492224 GGGGCTCTCCGCGCGGCTGCGGG - Intronic
1092193195 12:6534639-6534661 GGATGTGTTCGCGCCGCTGCGGG + Intronic
1092499503 12:9031455-9031477 GGACTTCAACGGGCCGCTGCTGG + Intergenic
1104489660 12:129183019-129183041 AGGCTTCTTCACGTGGCTGCTGG + Intronic
1104656398 12:130576700-130576722 GGGCTCCTCCTCGCTGCTGCTGG - Intronic
1113890530 13:113732961-113732983 GGACTTCTGCGAGGCGCTGCTGG + Exonic
1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG + Exonic
1114658987 14:24332919-24332941 GGGCGGCTTCTCGCTGCTGCTGG - Exonic
1119432551 14:74578031-74578053 GGGCTTCTGTGTGCTGCTGCGGG - Intronic
1122651793 14:103230464-103230486 GGGGTTCCTGGAGCCGCTGCTGG + Intergenic
1127811452 15:62568781-62568803 GTGCTTCTTCCAGCAGCTGCAGG - Intronic
1128455467 15:67829117-67829139 GGGCGTCTTTGGGCCGCCGCAGG + Intronic
1132592928 16:734228-734250 GGACTTCTTCGCCCAGCAGCAGG - Exonic
1132618213 16:852663-852685 GGGCTCCTTCACCCCGCTCCAGG - Intergenic
1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG + Exonic
1136336451 16:29613713-29613735 GGGGTTCTTGACGCAGCTGCGGG - Intergenic
1137655125 16:50153131-50153153 GGGCTGCTGCGCGGCGCAGCGGG + Intronic
1139664557 16:68447253-68447275 GGGCTGCTCCGCTCCGATGCAGG - Intronic
1139963174 16:70729537-70729559 GGTCTGCTGCGAGCCGCTGCAGG - Intronic
1140753393 16:78046194-78046216 TGGCTTCCCCGGGCCGCTGCGGG + Intronic
1141957674 16:87383495-87383517 GGAGATCTTCGCGTCGCTGCCGG - Exonic
1150221213 17:63496888-63496910 GAGCTACTTCAAGCCGCTGCTGG + Exonic
1151574700 17:74946863-74946885 GGCCATCTTCGGGCCGCTGCTGG + Exonic
1158601882 18:58863334-58863356 GGGCGCCTTCTCGCCGCCGCCGG + Intronic
1158745632 18:60196455-60196477 GCGCTTCTTAGAGTCGCTGCTGG - Intergenic
1160867158 19:1261020-1261042 AGGCTTCGTCGCGCTGCTACTGG - Intronic
1162744627 19:12791604-12791626 GGGCTTTTGCGCACAGCTGCCGG + Exonic
1163390303 19:17026718-17026740 GGCCGTCCTCGCGCCGCCGCCGG + Exonic
1163433928 19:17283928-17283950 GGGCTTCTTCCAGCTGCTGGTGG - Exonic
1163667968 19:18611930-18611952 GGGCTGCTGCGCGGCGCTGCAGG + Intronic
1167377303 19:49119062-49119084 GGGCTAGTGCGCGCCACTGCCGG + Exonic
1167426640 19:49433006-49433028 GGGCTTCTCCGCGTCCCTTCAGG + Intronic
1167975780 19:53224860-53224882 GGCCTTCTCCGCGGCGCTCCGGG - Intergenic
1168297386 19:55384076-55384098 CGGCGTGTTCGCGCAGCTGCAGG - Exonic
930850955 2:55959671-55959693 GGCCTTCTTCTTGCCGCTGTTGG - Intergenic
935237679 2:101151721-101151743 AGCCTTCTTCTCGCAGCTGCAGG + Intronic
937222520 2:120349924-120349946 GGGCTTCTTCCAGCCCCCGCGGG + Exonic
937997041 2:127701930-127701952 GCGCTTCTTCGCAGCGCAGCAGG - Exonic
947765270 2:232633740-232633762 CGGCCTCCTCGCGCCGCAGCCGG - Exonic
1171152105 20:22836192-22836214 GGGCTTCTTCCCACAGCTGCTGG - Intergenic
1171431398 20:25085063-25085085 GGGCTTCTCAGAGCCGCGGCTGG + Intergenic
1174177353 20:48653363-48653385 GGGCCTCTTCGCGCCGACTCCGG + Exonic
1176179550 20:63742884-63742906 GCACTTCTTCGCGTCGCCGCGGG - Exonic
1181155407 22:20917216-20917238 GGGCCGCTGCGCGCCGCTGGGGG - Intergenic
1183328520 22:37207143-37207165 GGGCTTCTTCGGGCCGCTGCTGG - Exonic
1185278916 22:49961639-49961661 CCGCTTCTTCGCGCAGGTGCTGG + Exonic
950940169 3:16884331-16884353 GGGCTTCCTCTCGGCGCCGCGGG + Intronic
961827253 3:129605638-129605660 GAGCTTCTTGGCGTCGCCGCCGG + Exonic
963015691 3:140821885-140821907 GGGCTTCTTTGTGCAGCTTCAGG + Intergenic
963335551 3:143971130-143971152 CGGCTTCTTCGCGGCGCTTGGGG + Intergenic
965796749 3:172448284-172448306 GCTCTTCCCCGCGCCGCTGCTGG - Exonic
968596248 4:1487343-1487365 GGGCTTCCTCCCGCCGTTCCTGG + Intergenic
968653146 4:1767792-1767814 GGGCAGCTCCGGGCCGCTGCTGG - Intergenic
969368648 4:6716387-6716409 CTGCTTCGCCGCGCCGCTGCGGG + Exonic
971996977 4:33977485-33977507 GAGCTTCTTCCAGCCTCTGCTGG - Intergenic
985530594 5:431621-431643 GGGCTGCTAGGGGCCGCTGCTGG - Intronic
990694480 5:58400578-58400600 GGGCTTCTTCCTCCAGCTGCGGG + Intergenic
990694566 5:58401589-58401611 GGGCTTCTTCCTCCAGCTGCGGG + Intergenic
998253128 5:140565926-140565948 CGTCTTCTACACGCCGCTGCAGG - Exonic
1004317868 6:14606440-14606462 GAGCTCCTTCGTGCAGCTGCTGG + Intergenic
1005455996 6:26020584-26020606 GGGCTTTTTCACGCCGCCGGTGG - Exonic
1005474790 6:26197134-26197156 GGGCTTCTTCACGCCGCCGGTGG + Exonic
1005477776 6:26225249-26225271 GGGCTTCTTCACGCCGCCCGTGG - Exonic
1005480488 6:26250489-26250511 GGGCTTCTTCACGCCACCGGTGG + Exonic
1006794904 6:36725750-36725772 GGGCTCCATCGCACCGCAGCTGG + Intronic
1010244837 6:73653602-73653624 GGGCTTCTGCGCACCGAGGCAGG + Intronic
1019275851 7:175231-175253 GTGCTTCTTGGCCCCTCTGCAGG - Intergenic
1019470031 7:1214641-1214663 GGGAGGCTTCGGGCCGCTGCTGG - Intergenic
1019750905 7:2729131-2729153 GAGCCTCTTCGCGGCGCTGTTGG - Exonic
1020560546 7:9726143-9726165 GGCCGTCCTCGCGCCGCCGCCGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1025928028 7:65974671-65974693 GGGCTTCGACTGGCCGCTGCTGG - Exonic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1034365203 7:150540284-150540306 GGGCTCCTTTGAGCCGCAGCTGG + Intergenic
1041012502 8:53558674-53558696 GGGCTCCTTCACACCGCTTCAGG + Intergenic
1043572326 8:81618780-81618802 GGGCTTCTTGGCGCTTCTGAAGG - Intergenic
1049381003 8:142315716-142315738 GGGCTCCTTGGTGCTGCTGCTGG - Intronic
1049425601 8:142536653-142536675 GGACATCTTCGGCCCGCTGCAGG + Intronic
1060583523 9:124771709-124771731 GGGCCTCTCCCTGCCGCTGCGGG + Intergenic
1062050270 9:134443471-134443493 GGGCTGCTTCACGCCGCAGCAGG - Intergenic
1197754572 X:129984513-129984535 CGGCCTCTTGGCGCCCCTGCAGG - Intronic
1200216876 X:154371852-154371874 TGGCCCCTTCCCGCCGCTGCCGG - Intronic